검색
검색 팝업 닫기

Ex) Article Title, Author, Keywords

Article

Split Viewer

Original Article

J Environ Health Sci. 2021; 47(6): 530-539

Published online December 31, 2021 https://doi.org/10.5668/JEHS.2021.47.6.530

Copyright © The Korean Society of Environmental Health.

MTHFR, As3MT and GSTO1 Polymorphisms Influencing Arsenic Metabolism in Residents Near Abandoned Metal Mines in South Korea

폐금속광산 지역 주민의 비소 대사에 영향을 미치는 MTHFR, As3MT, GSTO1 유전자 다형성

Ulziikhishig Surenbaatar1 , Byoung-Gwon Kim1 , Hyun-Jin Son1 , Seong-Sik Cho2 , Gwon-Min Kim3,4 , Hyoun-Ju Lim3 , Jung-Yeon Kwon1 , Ki-Hwan Kim5 , Young-Seoub Hong1,3*

울지1, 김병권1, 손현진1, 조성식2, 김권민3,4, 임현주3, 권정연1, 김기환5, 홍영습1,3*

1Department of Preventive Medicine, College of Medicine, Dong-A University, 2Department of Occupational and Environmental Medicine, College of Medicine, Dong-A University, 3Heavy Metal Exposure Environmental Health Center, Dong-A University, 4Medical Research Institute, Pusan National University, 5GENCUBEPLUS Co., Ltd

1동아대학교 의과대학 예방의학교실, 2동아대학교 의과대학 직업환경의학교실, 3동아대학교 중금속노출 환경보건센터, 4부산대학교 의학연구원, 5(주)젠큐브플러스

Correspondence to:Department of Preventive Medicine, College of Medicine, Dong-A University, 32, Daesin gongwon-ro, Seo-gu, Busan 49201, Republic of Korea
Tel: +82-51-240-2888
Fax: +82-51-253-5729
E-mail: yshong@dau.ac.kr

Received: September 28, 2021; Revised: November 25, 2021; Accepted: November 25, 2021

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Highlights

ㆍ Consumption of locally produced rice was associated with urinary inorganic As exposure.
ㆍ Seafood consumption was associated with urinary organic As exposure.
ㆍ Individuals heterozygous in the MTHFR A222V had higher urinary arsenic species concentrations.
ㆍ Individuals heterozygous in the GSTO1 A140D had higher urinary MMA and DMA concentrations.

Background: In South Korea, areas around abandoned metal mines are designated as regions with high arsenic (As) contamination. However, studies assessing urinary As exposure, As metabolism, and relevant genetic polymorphisms in residents of these metal mine areas are lacking.
Objectives: To identify factors associated with As exposure and evaluate the effects of MTHFR, As3MT, and GSTO1 genetic polymorphisms on As metabolism in residents of abandoned metal mine areas by measuring urinary As species.
Methods: Urinary As species (arsenite [As3+], arsenate [As5+], monomethyl arsonic acid, and dimethylarsinic acid) were isolated using high-performance liquid chromatography in combination with inductively coupled plasma mass spectrometry (HPLC-ICP-MS). Four genetic polymorphisms (MTHFR A222V, MTHFR E429A, GSTO1 A140D, As3MT M287T) were analyzed in 144 residents of four areas around abandoned metal mines.
Results: The study sample was comprised of 34.7% men and 65.3% women, with a mean age of 70.7±10.9 years. The urinary inorganic As concentration was higher among those consuming more than half locally produced rice (0.31 μg/L) than those consuming less than half such rice (0.18 μg/L). The urinary dimethylarsinic acid concentration was higher in the group that had consumed seafood in the past day (31.68 μg/L) than in those who had not (22.37 μg/L). Furthermore, individuals heterozygous in the MTHFR A222V and GSTO1 A140D polymorphism had higher urinary arsenic species concentrations than did individuals with a wild type or homozygous for the variant allele.
Conclusions: Consumption of locally produced rice was associated with inorganic As exposure, whereas seafood consumption was associated with organic As exposure among residents of abandoned metal mine areas. There was no clear association between MTHFR A222V and GSTO1 A140D polymorphisms and As metabolism.

KeywordsUrinary arsenic speciation, genetic polymorphisms, MTHFR, As3MT, GST01, abandoned metal mine

비소는 환경 및 생태계에서 무기비소, 유기비소의 다양한 형태로 존재하며 그 형태에 따라 독성은 다양하게 나타난다.1) 무기비소는 환경 중에 널리 분포하는 주요 환경오염물질이며,2) 275가지 유해 환경오염물질 가운데 인체위해도가 높은 물질 중 하나이며 공중보건학적인 중요성이 높다.3)

무기비소의 주요 노출원은 비소에 오염된 물과 오염된 토양에서 재배된 쌀 등 농작물이며 유기비소의 경우 비소 함유량이 비교적 높은 어패류와 해조류 등의 식품의 섭취로 인해 주로 소화기계를 통해 노출된다. 특히 비소는 경구 섭취하였을 때, 소화관에서의 흡수율이 다른 중금속과는 달리 90% 정도로 매우 높다.4-6)

환경 중 무기비소는 인체 노출 흡수 후 위장관에서 arsenite (As3+), arsenate (As5+)로 빠르게 흡수된다. 이들은 인체 내에서 비소의 생체변형(biotransformation)이 일어나고 arsenate (As5+)가 inosine이나 thiol compound에 의해 arsenite (As3+)로 환원된다. 대부분의 arsenite (As3+)는 간에서 methylation 작용으로 monomethylarsonic acid (MMA)을 경유하여 dimethylarsinic acid (DMA)로 대사된다7-9)(Fig. 1). 일반적으로 3가 비소화합물이 5가 비소화합물보다 독성이 더 높으며10) 그 중에 MMA3+이 독성이 가장 강한 중간체이다.11,12)

Figure 1.The metabolic pathway of arsenic and methionine and folic acid cycles14,32)

비소 대사에 관여하는 주요 효소는 Purine nucleoside phosphorylase (PNP), 비소 메틸전달 효소(arsenic methyltransferase, As3MT), 글로타티온-S-전달 효소(glutathione-S-transferase, GST) 등 세 그룹으로 분류되는데 모두 유전적 다형성을 지니고 있다. PNP 효소는 arsenate (As5+)의 환원제로 제시되어 있다. 3가 비소 화합물인 arsenite (As3+)가 MMA로 메틸화할 때, 또는 MMA가 DMA로 메틸화할 때 As3MT 유전자가 직접적인 영향을 미치며13) methylenetetrahydrofolate reductase (MTHFR) 유전자는 1-탄소 대사 경로의 다른 요소들에 의존하여 간접적인 영향을 미치는 것으로 알려져 있다.14) Arsenate (As5+)가 arsenite (As3+)로, MMA5+가 MMA3+로, DMA5+가 DMA3+로 환원할 때 glutathione-S-transferase omega (GSTO1) 유전자가 영향을 미치는 것으로 알려져 있다.15)

비소에 노출 시 고혈압, 당뇨, 비만, 고중성지방, 대사증후군 등 만성질환 뿐만 아니라 피부암, 폐암 및 방광암 발생과 상당한 연관성이 있다고 보고되고 있어 비소 노출은 전세계적으로 매우 중요한 공중 보건 문제이다.4) 그럼에도 불구하고 비소가 인체에 영향을 미치는 발암 기전, 질병영향 및 인체 영향 수준에 대해서는 아직까지 명확히 규명되지 않아 많은 연구가 필요하다. 국외에서는 요 중 비소 노출 평가 및 비소 대사산물 패턴에 유전자 다형성이 미치는 영향에 관한 연구가 다수 수행되고 있으나, 국내에서는 이에 대한 연구가 매우 미흡한 실정이다.

폐금속광산 지역은 환경오염 취약지역으로 비소 오염도가 가장 높은 지역으로 분류된다. 본 연구는 폐금속광산 지역 주민을 대상으로 요 중 비소 종 농도를 측정하여 관련 노출 요인 및 MTHFR, As3MT, GSTO1 유전자들의 다형성이 인체 비소 대사에 미치는 영향을 평가하고자 하였다.

1. 연구 대상

2007년 환경부가 실시한 폐금속광산 예비 주민건강영향조사에서 중금속 오염도가 높게 나타난 폐금속광산 지역 중 4개의 폐금속광산 지역을 선정하여 각 지역별 30명을 목표로 모집하였다.

1차년도에 2개 마을의 79명, 2차년도에 역시 2개 마을의 65명을 모집하여 총 144명을 대상으로 조사하였다. 설문조사는 인구학적 및 사회∙경제적 특성, 중금속 취급 직업력 및 광산 관련 직업력, 흡연 및 음주력, 중금속 노출과 관련된 식이습관 등으로 구성된 국립환경과학원의 표준화 설문지를 사용하였다.

2. 요 중 비소 지표

요 중 비소 화학종은 Arsenite (As3+), Arsenate (As5+), Monomethyl arsonic acid (MMA), Dimethylarsinic acid (DMA)로 분리하여 분석하였다. 본 연구에서 As3+와 As5+의 합을 무기비소(inorganic arsenic (iAs))로, MMA와 DMA의 합을 유기비소(organic arsenic)로, As3+, As5+, MMA, DMA의 합을 총 비소(sumAs)로 각각 조작적 정의하였다.

3. 인체시료 체취

전혈 시료는 항응고제(EDTA)가 포함되어 있는 혈액채취용기(Vacutainer royal blue cap)에 채취하였으며 혈액시료는 응고되는 것을 막기 위해 부드럽게 위 아래로 8∼10회 섞어준 뒤 롤믹서(Roll mixer)에서 혼합하여 분석 전까지 –70°C에 보관하였다. 요 시료는 일시뇨로 전용 Urine cup (Polypropylene)을 사용하여 중간뇨를 직접 받도록 설명하여 10 mL 이상 채취한 뒤, 검사기관으로 이송 전까지 4°C에 보관하였다. 요 중 비소 종 분리 분석을 위해 전용 Conical tube (15 mL, Polypropylene)에 5 mL씩 분주하여 분석 시까지 –70°C인 초저온냉동고에 보관하였다.

4. 신체 시료 분석 방법

4.1. 유전자 분석

유전체 DNA는 HiGeneTM Genomic DNA추출 키트(Biofact, 대전, 한국)를 사용하여 혈액 샘플 전체로부터 분리됐다. 시퀀싱 전에, DNA는 95°C에서 15분 변성, 95°C에서 30초 변성의 32사이클, 50°C (Ta)에서 30초 어닐링, 72°C에서 30초 신장, 마지막으로 72°C에서 3분 신장 등의 PCR 조건을 이용하여 개발한 프라이머로 증폭하였다(Table 1). PRIMER 3 버전 0.4.0을 이용하여 프라이머를 설계하였다.

Table 1 PCR primer pairs and sequencing primer pairs

PurposeNameSequence 5' to 3'MerTa (°C)*
PCRMTHFR A222V-FGAGGCTGACCTGAAGCACTTG2156
PCR, sequencingMTHFR A222V-RGTGGGGTGGAGGGAGCTTAT20
PCR, sequencingMTHFR E429A-FATTCCTCTTCCCCTGCCTTTG2156
PCRMTHFR E429A-RTCCCCACTCCAGCATCACTC20
PCR, sequencingGSTO1 A140D-FGGGGGCCGATACAGTTAGC1956
PCRGSTO1 A140D-RAGCAAGCCCATGACAAAGTCT21
PCR, sequencingAs3MT M287T-FGAGTGCTGGAGATGAACCGTGA2256
PCRAs3MT M287T-RGGGCAAGAGCAGAAAGAATACCAGA25

*Ta is annealing temperature.


PCR은 30 ng의 DNA 주형, 10 mM의 dNTP, 10배의 반응용 완충액, 순방향 및 역방향 프라이머 각 10 pM, 5U HAN Taq 중합효소로 구성된 총 20 μL의 반응 용액에서 수행하였으며(HanLab, 서울, 한국) 나머지는 증류수로 채워졌다. 그런 다음 각 PCR 제품은 0.5배의 TBE 완충액에서 EtBr로 염색된 1%의 아가로스 젤 위에서 전기 영동 처리하였다.

4.2. 요 중 비소 종 분리 분석

비소화학종 농도 분리 정량을 위해, 요 시료는 0.45 µm 필터로 불순물 제거 후 탈이온수로 10배 희석하였다. Hamilton PRP X-100 column이 장착된 LC/ICP-MS (Agilent Technologies 1,260 series High-Performance Liquid Chromatography/7,700 series Inductively Coupled Plasma-Mass Spectrometer, Agilent, Santa Clara, CA, USA) 장비를 이용하여 As3+, As5+, MMA, DMA의 4개 비소종을 정량 분석하였다. As3+, As5+, MMA, DMA 그리고 standard 시료(Sigma-Aldrich, St. Louis, MO, USA)를 사용하여 Calibration curves을 작성하였고 2개 표준물질(Standard Reference Material 2,669, The National Institute of Standards and Technology, Gaithersburg, MD, USA; Certified Reference Material No. 18, National Institute for Environmental Studies, Onogawa, Tsukuba, Japan)를 이용하여 정확성을 확인하였다. 외부 질 보증은 Friedrich-Alexander University에서 운영하는 German External Quality Assessment Scheme (G-EQUAS)의 Quality Assurance Program에서 인증을 받았다.16)

5. 통계분석방법

통계 분석은 R 통계 패키지를 이용하였다. 요 중 비소 종 농도가 오른 쪽으로 치우친 분포를 보여 자연 로그 변환 후 기하평균(GM), 95% 신뢰구간(95% CI)을 사용하였다. 대상자의 일반적특성 및 유전자형에 따른 요 중 비소 종 농도를 비교하는 데 있어 t-검정(t-test) 및 분산분석(Analysis of variance, ANOVA)을 실시하였다. 모든 검정은 유의수준 5% 미만에서 실시되었다.

1. 대상자의 일반적 특성

대상자들의 일반적 특성은 Table 2와 같다. 성별은 34.7%은 남성, 65.3%은 여성이었으며 평균 연령은 70.7±10.9세로, 70세 이하인 군이 48.6%, 70세 이상인 군이 51.4%를 차지하였다. 주 식수원으로는 지하수나 간이상수도를 음용하는 대상자가 69.2%를 차지하고 있었다. 거주 지역 내에서 생산되는 쌀을 절반 이상 섭취하는 군이 45.8%, 최근 1일 내 해산물을 섭취한 대상자가 40.3%였다. MTHFR A222V 유전자형 분포는 wild형(CC) 34.8%, 이형접합형(CT) 28.9%, 동형접합형(TT) 36.6%, MTHFR E29A 유전자형의 경우 wild형(AA) 81.1%, 이형접합형(AC) 16.8%, 동형접합형(CC) 2.1%, GSTO1 A140D 유전자형 분포는 wild형(CC) 70.4%, 이형접합형(CA) 15.5%, 동형접합형(AA) 14.1%, As3MT M287T 유전자형의 경우 wild형(TT) 96.4%, 이형접합형(TC) 0.7%, 동형접합형(CC) 2.9%로 나타났다.

Table 2 Study subject general characteristics

CharacteristicsTotal n (%)
Total144 (100)
Age*Mean±SD70.7±10.9
<7070 (48.6)
≥7074 (51.4)
BMI (kg/m²)*Mean±SD24.4±3.44
<2587 (60.4)
≥2557 (39.6)
Month income (₩10,000)No response19 (15.8)
<5073 (60.8)
50~<20013 (10.8)
≥20015 (12.5)
Smoking statusCurrent smoker17 (11.8)
Former20 (13.9)
Never107 (74.3)
Drinking statusCurrent52 (36.1)
Former22 (15.3)
Never70 (48.6)
Drink waterGround water99 (69.2)
Other44 (30.8)
Mining work experienceYes14 (9.7)
No130 (90.3)
PesticideYes90 (62.5)
No54 (37.5)
Intake of locally grown riceMore than half66 (45.8)
Less than half78 (54.2)
Intake of seafood in last one dayYes58 (40.3)
No86 (59.7)
MTHFR A222V (C→T)CC47 (34.8)
CT39 (28.9)
TT49 (36.3)
MTHFR E429A (A→C)AA116 (81.1)
AC24 (16.8)
CC3 (2.1)
GSTO1 A140D (C→A)C/C100 (70.4)
C/A22 (15.5)
A/A20 (14.1)
As3MT M287T (T→C)T/T134 (96.4)
T/C1 (0.7)
C/C4 (2.9)

SD: Standard deviation, *Cut point is median value of this variable.


2. 대상자 일반적 특성에 따른 요 중 비소 농도

대상자의 일반적 특성에 따른 요 중 비소 농도는 Table 3과 같다. 성별로는 모든 비소 종 농도가 남성이 여성에 비해 높았으나 통계적으로 유의하지 않았다. 연령에 따른 요중 비소 종 농도는 통계적으로 유의한 차이가 관찰되지 않았다. 가정의 주 식수로 지하수를 이용하는 군의 무기비소는 그 외의 식수를 이용하는 군과 농도 차이가 관찰되지 않았다. 반면 MMA와 DMA가 지하수를 이용하는 군이 그 외의 식수를 이용하는 군에 비해 높았으나 통계적으로 유의하지 않았다. 무기비소의 경우 거주 지역 내 생산되는 쌀을 절반 이상 섭취하는 경우 0.31 (0.22~0.45) μg/L로서 절반 미만을 섭취하는 군 0.18 (0.13~0.26) μg/L에 비해 통계적으로 유의하게 높았으며 MMA와 DMA의 경우도 역시 각각 0.62 (0.37~1.00) μg/L, 35.08 (27.69~44.11) μg/L로서 거주 지역 내 생산되는 쌀을 절반 이상 섭취하는 군이 절반 미만 섭취하는 군의 MMA 0.24 (0.14~0.41) μg/L 및 DMA 17.47 (13.67~22.92) μg/L에 비해서 유의하게 높은 농도로 관찰되었다. 최근 1일 내 해산물을 섭취한 군의 DMA 농도가 31.68 (23.47~42.96) μg/L로서 해산물을 섭취하지 않은 군 22.37 (18.14~22.88) μg/L에 비해서 통계적으로 유의하게 높았다.

Table 3 Urinary arsenic species concentration by subject characteristics (μg/L)

TotalArsenic measures GM (95% CI)

iAsMMADMAsumAs




0.25 (0.20~0.31)0.41 (0.30~0.57)25.73 (21.92~30.63)27.79 (23.65~32.85)
Gender
Male (n=50)0.29 (0.19~0.44)0.52 (0.27~0.95)31.14 (22.77~42.35)33.65 (24.60~45.68)
Female (n=94)0.23 (0.17~0.30)0.36 (0.24~0.55)23.25 (18.80~28.75)25.09 (20.32~30.89)
Age
<70 (n=70)0.26 (0.19~0.38)0.38 (0.22~0.67)31.12 (23.90~39.53)33.35 (25.56~42.36)
≥70 (n=74)0.24 (0.17~0.33)0.43 (0.26~0.68)21.50 (16.80~27.05)23.38 (18.27~29.44)
BMI
<25 (n=87)0.25 (0.18~0.36)0.39 (0.24~0.60)23.79 (19.08~29.36)25.68 (20.62~31.62)
≥25 (n=57)0.24 (0.17~0.35)0.44 (0.24~0.81)29.01 (20.80~39.25)31.33 (22.63~42.13)
Smoking status
Current (n=17)0.37 (0.17~0.78)0.37 (0.13~1.09)20.62 (11.61~35.36)22.47 (12.55~38.33)
Former (n=20)0.18 (0.10~0.33)0.39 (0.13~1.23)28.35 (17.65~44.33)30.23 (18.18~48.13)
Never (n=107)0.25 (0.19~0.33)0.41 (0.27~0.62)26.18 (21.31~31.95)28.29 (23.16~34.47)
Drinking status
Current (n=52)0.20 (0.14~0.29)0.32 (0.18~0.58)24.54 (18.45~31.93)26.10 (19.58~33.92)
Former (n=22)0.29 (0.16~0.54)0.83 (0.36~1.93)23.91 (14.13~39.66)26.83 (16.12~44.14)
Never (n=70)0.28 (0.19~0.39)0.39 (0.24~0.65)27.28 (21.35~35.67)29.43 (23.04~38.39)
Drink water
Ground water (n=99)0.24 (0.18~0.33)0.50 (0.33~0.76)27.23 (21.96~33.44)29.48 (23.76~36.22)
Other (n=44)0.25 (0.17~0.41)0.27 (0.14~0.54)22.65 (16.11~32.06)24.31 (17.30~34.07)
Mining work experience
Yes (n=14)0.21 (0.10~0.48)0.26 (0.07~1.02)17.67 (9.68~32.49)19.50 (10.56~35.47)
No (n=130)0.25 (0.20~0.33)0.43 (0.28~0.62)26.80 (22.18~32.12)28.86 (23.92~34.55)
Pesticide
Yes (n=90)0.29 (0.22~0.41)*0.47 (0.29~0.73)25.99 (21.28~32.21)28.20 (23.12~34.87)
No (n=54)0.18 (0.13~0.27)0.32 (0.17~0.57)25.31 (18.54~33.94)27.11 (19.94~35.99)
Intake of locally grown rice
Less than half (n=64)0.18 (0.13~0.26)***0.24 (0.14~0.41)***17.47 (13.67~22.92)***18.81 (14.74~24.58)***
More than half (n=80)0.31 (0.22~0.45)0.62 (0.37~1.00)35.08 (27.69~44.11)37.96 (29.96~47.70)
Intake of seafood
Yes (n=58)0.20 (0.14~0.30)0.34 (0.18~0.66)31.68 (23.47~42.96)*33.24 (24.43~45.13)*
No (n=86)0.29 (0.21~0.39)0.46 (0.29~0.72)22.37 (18.14~22.88)24.62 (19.91~30.44)

GM: geometric means, CI: confidence interval, ANOVA: analysis of variance. The p-value indicates the difference of urinary arsenic species concentration between subgroups using 1-way ANOVA or independent sample T-test.

*p<0.05, **p<0.01, ***p<0.001.


3. 유전자형에 따른 요 중 비소 농도

유전자형에 따른 요 중 비소 종별 농도가 Table 4에 제시되어 있다. MTHFR A222V 유전자의 경우 이형접합형(CT)을 보인 군의 무기비소, MMA 및 DMA가 wild형(CC) 및 동형접합형(TT)에 비해 통계적으로 유의하게 높은 농도를 보였다. 무기비소를 제외한 MTHFR E429A 유전자형에 따른 요 중 비소종별 농도의 유의한 차이는 관찰되지 않았다. MTHFR E429A 유전자형의 이형접합형/동형접합형(AC+CC) 군의 무기비소 농도는 wild형(AA)보다 유의하게 높은 농도로 확인되었다. GSTO1 A140D 유전자의 경우 무기비소는 이형접합형(CA)가 wild형(CC)과 동형접합형(AA)에 비해서 높은 농도를 보였으나 통계적으로 유의하지 않았다. 반면에 MMA과 DMA가 GSTO1 A140D 유전자의 이형접합형(CA)에서 wild형(CC)과 동형접합형(AA)을 보인 군에 비해서 유의하게 높았다(Fig. 2). As3MT M287T 유전자형에 따른 요 중 비소 농도의 뚜렷한 차이는 관찰되지 않았다.

Table 4 Urinary arsenic species concentration by genotype (μg/L)

TotalArsenic measures GM (95% CI)

iAsMMADMAsumAs




0.25 (0.20~0.31)0.41 (0.30~0.57)25.73 (21.92~30.63)27.79 (23.65~32.85)
MTHFR A222V
CC (n=47)0.27 (0.18~0.41)***ab0.35 (0.19~0.67)***b23.77 (17.57~32.72)***ab25.68 (19.12~34.93)***ab
CT (n=39)0.33 (0.19~0.58)a0.79 (0.40~1.61)a48.47 (37.91~61.27)a52.72 (41.75~65.97)a
TT (n=49)0.17 (0.12~0.25)b0.25 (0.15~0.45)b16.39 (12.15~22.08)b17.57 (13.02~23.77)b
MTHFR E429A
AA (n=116)0.24 (0.18~0.31)*0.40 (0.27~0.60)23.59 (19.22~29.06)25.45 (20.85~31.45)
AC+CC (n=27)0.30 (0.17~0.57)0.42 (0.17~1.07)37.25 (27.52~50.40)40.38 (29.68~54.58)
GSTO1 A140D
C/C (n=100)0.23 (0.17~0.30)0.41 (0.26~0.63)**ab26.52 (21.18~32.48)**ab28.60 (23.00~34.94)**ab
C/A (n=22)0.35 (0.18~0.70)0.61 (0.19~1.64)a42.10 (28.73~58.90)a45.95 (31.49~64.38)a
A/A (n=20)0.26 (0.14~0.49)0.21 (0.09~0.51)b13.57 (9.16~20.73)b14.53 (9.69~22.47)b
As3MT M287T
T/T (n=134)0.24 (0.19~0.31)0.42 (0.29~0.64)25.87 (21.50~31.03)27.92 (23.20~33.53)
T/C (n=1)2.85 (0.00~0.00)0.04 (0.00~0.00)10.96 (0.00~0.00)13.86 (0.00~0.00)
C/C (n=4)0.15 (0.08~0.59)0.28 (0.03~2.75)10.20 (2.70~54.58)11.03 (2.81~59.31)

GM: geometric means, CI: confidence interval, ANOVA: analysis of variance. The p-value indicates the difference of urinary arsenic species concentration between subgroups using 1-way ANOVA or independent sample T-test; abc, Bonferroni post-hoc grouping; estimates with the same letter are not significantly different.

*p<0.05, **p<0.01, ***p <0 .001.

Figure 2.The geometric mean of the iAs, MMA and DMA by genotype of MTHFR A222V, MTHFR E429A and GSTO1 A140D
aHeterozygotes and homozygotes for the variant allele in the MTHFR E429A polymorphism are combined.
*p<0.05, **p<0.01, ***p<0.001

본 연구에서 폐금속광산 지역 주민의 요 중 비소 종 농도 측정 및 인체 비소 대사와 관련된 유전자 다형성에 대한 분석을 하였으며 거주 지역 내 생산되는 쌀을 절반 이상 섭취하는 경우 절반 미만을 섭취하는 군에 비하여 요 중 무기비소 농도가 높았다. 최근 1일 내 해산물을 섭취한 군의 요 중 DMA 농도가 해산물을 섭취하지 않은 군에 비하여 높은 결과를 보였다. MTHFR A222V 및 GSTO1 A140D 유전자의 이형접합형이 wild형 및 동형접합형에 비하여 비소 종 농도가 높은 것으로 나타났다. 비소 대사와 관련된 효소 조절에서의 유전적 다형성이 개인과 인구 집단 간 비소 대사의 현저한 차이의 한 가지 원인이 될 수 있다. 따라서 본 연구 결과를 통해 비소노출 취약지역 주민의 비소생체지표 농도를 예측하는 또는 영향을 미치는 요소를 식별하여 이를 기반으로 위험군을 선별하여 관리할 수 있다.

다양한 인구 집단에서 요 중 비소 대사 산물의 비율은 비소 노출 수준과 상관 없이 일반적으로 10~30%를 iAs, 10~20%를 MMA, 60~80%를 DMA가 차지한다.17) 그러나 개인 및 인구 집단 간의 요 중 비소 패턴은 상당한 차이가 있다. 특히 DMA는 지배적인 메틸화 비소 종으로 간주된다.18) 그럼에도 불구하고 한국인들은 해산물 섭취가 다소 높기 때문에 요 중 DMA 비율이 더 높은 편이다.19) 본 연구에서 요 중 비소 대사 산물의 비율 순서는 %DMA>%MMA>%iAs이었다. 일부 연구에서는 음용수를 통해 비소 노출 후 배출된 주요 비소 대사 산물이 %DMA>%iAs>%MMA 순이었다.20,21) 본 연구에서 요 중 비소 대사 산물의 평균 비율이 iAs-2.58%, MMA-4.49%, DMA-92.93%이었다.

체질량지수는 비만 및 영양 상태를 나타내는 지표로서 비소 대사에 영향을 미칠 수 있다. BMI와 비소 메틸화 효율 간의 상관성을 평가한 연구에서 BMI가 증가할수록 %MMA가 감소한 것을 확인하였다.22) 그러나 본 연구에서는 BMI와 요 중 비소 종 농도의 연관성을 확인하지 못하였다. 많은 선행 연구들에서 성별, 연령, 체질량지수가 비소 대사에 영향을 미친다는 것을 보고하였지만 본 연구에서는 연관성을 확인하지 못한 것은 대상자 수가 적기 때문일 수 있으며 추후 대규모 대상자로 연구할 필요성이 있다.

무기비소의 노출은 주로 식습관과 식수를 통해 발생하며 저농도의 비소오염 식수는 무기비소 노출의 중요한 원인이 될 수 있다. Chang 등23) 의 연구에서 오염된 일부 폐광산지역 주민을 대상으로 요 중 비소 종분리 분석한 연구에서 무기비소 기하평균이 상수도 공급 시행 전 23.13 μg/L이었으며, 상수도 공급 시행 후 1.70 μg/L로 대폭 감소한 것으로 보고하였다. 또한 거주 지역 내에서 생산된 쌀을 섭취하는 군의 요 중 총 비소 농도가 높았다.23) 폐광산 지역에서 실시한 다른 연구에서도 무기비소의 노출 요인으로 음용수의 비소오염 및 지역 내에서 생산된 쌀을 섭취하는 것을 들었으며19,24,25) 본 연구에서도 지역 내에서 생산된 쌀을 절반 이상 섭취하는 군이 절반 미만을 섭취하는 군에 비하여 요 중 무기비소 농도가 유의하게 높은 것으로 확인되었다. 따라서 오염지역의 식수와 농산물을 섭취하는 폐금속광산지역이 비소노출의 취약지역임을 알 수 있으며 폐금속광산지역 주민의 비소노출에 대한 지속적인 건강영향 관리체계의 구축이 필요하다.

한국인은 해산물 섭취량이 많기 때문에 비소에 대한 노출을 평가하는 데 있어서 해산물 섭취가 고려되어야 할 중요한 요인이다. 본 연구에서는 최근 1일 내 해산물을 섭취한 군의 요 중 DMA 농도가 해산물을 섭취하지 않은 군에 비하여 유의하게 높은 결과를 보였다. 해산물의 영향을 배제하려면 며칠간 해산물 섭취를 금식한 상태에서 측정해야 하나 본 연구에서는 금식 조절을 하지 못하였으며 추후 연구에서는 해산물을 금식한 상태에서 조사할 필요성이 있다.

많은 연구에 따르면 식습관, 성별, 연령, 체질량지수 및 개인의 생활습관과 같은 개인적 특성과 환경 요인들이 비소 대사에 영향을 미친 것으로 나타났다.8,26,27) 최근 역학 연구에서 비소 메틸화 능력 저하는 피부병변, 피부암, 방광암, 고혈압 등과 같은 비소 노출과 관련된 질병과 관련이 있는 것으로 보고되고 있다.28-30)

본 연구에서 As3MT M287T 유전자의 이형접합형을 가진 사람은 한 명, 동형접합형을 가진 사람은 네 명으로 나타났으며 이러한 유전자 다형성의 낮은 빈도는 다른 아시아인을 대상으로 한 연구 결과와 유사하였다.31) Lindberg 등14)As3MT M287T 유전자의 다형성, 성별 및 체질량지수는 중부 유럽 인구의 요 중 비소 대사에 영향을 미치는 주요 요인으로 보고하였다. González-Martínez 등32)의 연구에서 As3MT M287T 이형접합/동형접합형은 DMA의 더 낮은 농도와 관련이 있는 것으로 보고하였다. 또한 González-Martínez 등32)As3MT M287T의 이형접합/동형접합형은 wild형에 비하여 %MMA가 더 높은 것을 확인하였으며 이러한 결과는 유럽, 아시아 및 중남미 인구에서 보고된 것과 유사했다고 보고되었다. 그러나 본 연구에서는 성별, 연령, 체질량지수 및 As3MT 유전자의 다형성이 요 중 비소 대사와 관련이 없는 것으로 관찰되었다. 향후 대규모 집단을 대상으로 As3MT 유전자 내 다른 SNP들을 연구할 필요가 있다.

Lindberg 등14)의 연구에서 MTHFR A222V 유전자의 동형접합형에서 더 높은 %MMA를 확인하였는데, 그 결과는 본 연구와 상반 결과였으며 더 낮은 %DMA는 본 연구의 MTHFR A222V 유전자의 동형접합형에서 DMA 농도가 낮은 결과와 유사하였다. Steinmaus 등33)의 연구에서는 본 연구와 동일하게 MTHFR A222V 및 E429A 유전자형이 비소 대사에 미치는 영향을 조사하였으며 A222V 유전자형의 동형접합형이 높은 농도의 iAs와 관련이 있다는 것은 본 연구 결과와 다른 반면, 낮은 농도의 DMA와 관련이 있다는 것은 본 연구와 유사하였다. 또한 E429A 유전자형의 wild형이 iAs의 높은 농도 및 DMA의 낮은 농도를 보여 주는 결과는 본 연구와 상반 결과를 보였다.33) MTHFR 유전자는 메틸렌테트라하이드로폴레이트(methylenetetrahydrofolate)를 메틸테트라하이드로폴레이트(methyltetrahydrofolate)로 환원시키는데, 이는 메틸화된 비타민 B12를 공통 인자로 하여 1-탄소 대사에서 호모시스테인(homocysteine)으로부터 메티오닌(methionine)을 재생한다(Fig. 1). MTHFR A222V 유전자의 다형성은 효소 활동 감소 및 억제를 통해 더 낮은 SAM-의존성 메메틸화로 이어질 수 있어 본 연구의 MTHFR A222V 유전자의 이형접합형에서 더 높은 비소 농도 결과를 설명할 수 있다.

GSTO1 유전자의 A140D 대립유전자의 빈도는 세계 인구마다 크게 다르다.34) 본 연구에서 GSTO1 A140D 유전자 다형성 빈도는 인도의 연구 및 중국의 연구와 비슷하였으며 이는 아시아 인구 내 유사성을 반영한다. Luo 등35)의 중국인을 대상으로 한 연구에서 GSTO1 A140D 유전자의 이형접합형을 지닌 대상자가 wild형을 지닌 대상자에 비하여 GSTO1 효소 활동이 감소한 것으로 나타났으며 이러한 결과는 본 연구와 유사하였다. Fu 등26)GSTO1 A140D 유전자의 이형접합형이 wild형에 비하여 %DMA가 유의하게 낮은 것을 보고하였으며 이러한 결과는 본 연구에서 확인한 GSTO1 A140D 유전자의 이형접합형과 DMA 농도의 증가와 유의한 관련이 있다는 것과 상반된 내용이다. 반면에 Chen 등36), Pavia 등37)GSTO1 A140D 유전자형은 비소 대사에 크게 영향을 미치지 않는다는 결과를 보고한 바가 있다. 일반적으로 GSTO1 유전자는 다른 GST보다 티올 전이효소 활동이 더 높다.38,39) 또한 Chung 등40)GSTO1 A140D의 wild형을 가진 대상자들이 이형접합형 및 동형접합형을 지닌 대상자와 비교하여 MMA 농도가 유의하게 증가했다고 보고하였다. Tanaka-Kawaga 등41)GSTO1 A140D 변이의 티올 전이효소 활동은 wild형에 대비 75%에 불과하여 A140D 유전자의 다형성은 GSTO1의 티올 전이효소 활동을 감소시킨다고 주장하였다. 따라서 본 연구에서 GSTO1 A140D 유전자 이형접합형을 지닌 대상자의 요 중 MMA 및 DMA 농도가 높은 결과를 GSTO1의 티올 전이효소 활동의 감소로 설명할 수 있으나 Whitbread 등42)GSTO1 A140D 유전자 다형성들 사이에 이러한 효소 활동 차이가 관찰되지 않았다고 보고한 바가 있다. 이와 같이 많은 선행 연구에서 다양한 결과를 보고되고 있다.

본 연구의 MTHFR A222V 및 GSTO1 A140D 유전자의 이형접합형에서 더 높은 비소 농도 결과를 유전자 다형성에 따른 효소 활동 감소로 설명할 수 있으나 동형접합성에서 더 낮은 농도 비소 결과에 대한 설명을 못했다. 이러한 결과는 본 연구의 적은 연구대상자에 의해서 유전자 분포의 영향을 미쳤을 것으로 보인다. 향후 대상자수가 확대된다면 차이점이 보완될 것으로 보인다. 본 연구의 강점으로는, 국내 비소노출의 대표적인 취약지역인 폐금속광산 지역 주민을 대상으로 하였다는 점과 아울러, 비소 대사에 영향을 미치는 유전자 다형성에 대한 국내의 최초 연구라는 점이다. 제한점으로는 첫째, 단면연구로서 비소 노출에 대한 요인분석 파악이 한계가 있었다는 점이다. 둘째, 대상자 수가 부족하였다는 점이다. 셋째, 일시뇨의 농축정도를 보정하는데 이용하는 요중 크레아티닌과 요비중을 측정하지 못하였다는 점이다. 향후, 한국인의 인체 비소 대사와 관련이 있는 유전적 특성에 대한 대규모의 전향적 연구가 수행되기를 바란다.

폐금속광산 지역 주민의 요 중 무기비소의 노출 요인은 지역 내에서 생산된 쌀 섭취로, 유기비소의 노출 요인은 해산물 섭취로 분석되었다. MTHFR A222V, GSTO1 A140D 유전자 다형성과 비소 대사와의 명확한 상호작용을 나타내지 못했다. 비소의 위험성과 공중보건학적인 중요성을 고려할 때 본 연구는 비소 취약지역 주민을 대상으로 노출 및 대사 특성을 규명하고자 시도한 연구로써 의미가 크다. 향후 대규모 집단을 대상으로 비소 대사 관련 연구가 확대되기를 바란다.

본 연구는 환경부 지정 동아대학교 중금속노출 환경보건센터의 지원을 받아 수행되었으며 이에 감사드립니다(IRB No. 2-1040709-AB-N-01-201908-BR-012-04).

울지(연구원), 김병권(교수), 손현진(교수), 조성식(교수), 김권민(연구원), 임현주(연구원), 권정연(연구원), 김기환(대표), 홍영습(교수)

  1. Mandal BK, Suzuki KT. Arsenic round the world: a review. Talanta. 2002; 58(1): 201-235.
    CrossRef
  2. Ministry of Food and Drug Safety/National Institute of Food and Drug Safety Evaluation. Exposure Assessment to Arsenic by Total Arsenic and Speciation Analyses in Urine. Cheongju: Ministry of Food and Drug Safety; 2014. https://scienceon.kisti.re.kr/srch/selectPORSrchReport.do?cn=TRKO201400011751
  3. Agency for Toxic Substances and Disease Registry (ATSDR). Toxicological Profile for Arsenic. 2007. Available: https://www.atsdr.cdc.gov/toxprofiledocs/index.html [accessed 25 April 2021]. https://www.atsdr.cdc.gov/toxprofiledocs/index.html
  4. Hong YS, Ye BJ, Kim YM, Kim BG, Kang GH, Kim JJ, et al. Investigation of health effects according to the exposure of low concentration arsenic contaminated ground water. Int J Environ Res Public Health. 2017; 14(12): 1461.
    Pubmed KoreaMed CrossRef
  5. Seo JW, Choi JW, Oh YJ, Hong YS. Biological monitoring of arsenic concentrations according to exposure to arsenic-contaminated ground water. J Environ Health Sci. 2020; 46(5): 513-524. https://www.kci.go.kr/kciportal/ci/sereArticleSearch/ciSereArtiView.kci?sereArticleSearchBean.artiId=ART002639825
  6. Bae HS, Ryu DY, Choi BS, Park JD. Urinary arsenic concentrations and their associated factors in Korean adults. Toxicol Res. 2013; 29(2): 137-142.
    Pubmed KoreaMed CrossRef
  7. Vahter M. Mechanisms of arsenic biotransformation. Toxicology. 2002; 181-182: 211-217.
    CrossRef
  8. Tseng CH. Arsenic methylation, urinary arsenic metabolites and human diseases: current perspective. J Environ Sci Health C Environ Carcinog Ecotoxicol Rev. 2007; 25(1): 1-22.
    Pubmed CrossRef
  9. Vahter M. Variation in human metabolism of arsenic. In: Chappell WR, Abernathy CO, Calderon RL. editors. Arsenic Exposure and Health Effects III, 1st ed. Oxford: Elsevier Science; 1999. p.267-279. https://www.sciencedirect.com/science/article/pii/B9780080436487500315
    CrossRef
  10. Hughes MF, Beck BD, Chen Y, Lewis AS, Thomas DJ. Arsenic exposure and toxicology: a historical perspective. Toxicol Sci. 2011; 123(2): 305-332.
    Pubmed KoreaMed CrossRef
  11. Petrick JS, Ayala-Fierro F, Cullen WR, Carter DE, Vasken Aposhian H. Monomethylarsonous acid (MMA(III)) is more toxic than arsenite in Chang human hepatocytes. Toxicol Appl Pharmacol. 2000; 163(2): 203-207.
    Pubmed CrossRef
  12. Stýblo M, Drobná Z, Jaspers I, Lin S, Thomas DJ. The role of biomethylation in toxicity and carcinogenicity of arsenic: a research update. Environ Health Perspect. 2002; 110(Suppl 5): 767-771.
    Pubmed KoreaMed CrossRef
  13. Engström K, Vahter M, Mlakar SJ, Concha G, Nermell B, Raqib R, et al. Polymorphisms in arsenic(+III oxidation state) methyltransferase (AS3MT) predict gene expression of AS3MT as well as arsenic metabolism. Environ Health Perspect. 2011; 119(2): 182-188.
    Pubmed KoreaMed CrossRef
  14. Lindberg AL, Kumar R, Goessler W, Thirumaran R, Gurzau E, Koppova K, et al. Metabolism of low-dose inorganic arsenic in a central European population: influence of sex and genetic polymorphisms. Environ Health Perspect. 2007; 115(7): 1081-1086.
    Pubmed KoreaMed CrossRef
  15. McClintock TR, Chen Y, Bundschuh J, Oliver JT, Navoni J, Olmos V, et al. Arsenic exposure in Latin America: biomarkers, risk assessments and related health effects. Sci Total Environ. 2012; 429: 76-91.
    Pubmed KoreaMed CrossRef
  16. Chung JY, Lim HJ, Kim YJ, Song KH, Kim BG, Hong YS. The separation of arsenic metabolites in urine by high performance liquid chromatographyinductively coupled plasma-mass spectrometry. Environ Health Toxicol. 2014; 29: e2014018.
    Pubmed KoreaMed CrossRef
  17. Bustaffa E, Gorini F, Bianchi F, Minichilli F. Factors affecting arsenic methylation in contaminated Italian areas. Int J Environ Res Public Health. 2020; 17(14): 5226.
    Pubmed KoreaMed CrossRef
  18. Tseng CH. A review on environmental factors regulating arsenic methylation in humans. Toxicol Appl Pharmacol. 2009; 235(3): 338-350.
    Pubmed CrossRef
  19. Surenbaatar U, Seo JW, Kim BG, Lim HJ, Chang JY, Lee CW. Urinary arsenic species concentrations and related factors among residents living near abandoned metal mines. J Environ Health Sci. 2020; 46(6): 655-666. https://koreascience.or.kr/article/JAKO202001239070187.view
  20. Sun G, Xu Y, Li X, Jin Y, Li B, Sun X. Urinary arsenic metabolites in children and adults exposed to arsenic in drinking water in Inner Mongolia, China. Environ Health Perspect. 2007; 115(4): 648-652.
    Pubmed KoreaMed CrossRef
  21. Del Razo LM, García-Vargas GG, Vargas H, Albores A, Gonsebatt ME, Montero R, et al. Altered profile of urinary arsenic metabolites in adults with chronic arsenicism. A pilot study. Arch Toxicol. 1997; 71(4): 211-217.
    Pubmed CrossRef
  22. Gomez-Rubio P, Roberge J, Arendell L, Harris RB, O'Rourke MK, Chen Z, et al. Association between body mass index and arsenic methylation efficiency in adult women from southwest U.S. and northwest Mexico. Toxicol Appl Pharmacol. 2011; 252(2): 176-182.
    Pubmed KoreaMed CrossRef
  23. Chang JY, Ahn SC, Lee JS, Kim JY, Jung AR, Park J, et al. Exposure assessment for the abandoned metal mine area contaminated by arsenic. Environ Geochem Health. 2019; 41(6): 2443-2458.
    Pubmed KoreaMed CrossRef
  24. Cho Y, Seo S, Choi SH, Lee S, Kim K, Kim HJ, et al. Association of arsenic levels in soil and water with urinary arsenic concentration of residents in the vicinity of closed metal mines. Int J Hyg Environ Health. 2013; 216(3): 255-262.
    Pubmed CrossRef
  25. Chung JY, Kim BG, Lee BK, Moon JD, Sakong J, Jeon MJ, et al. Urinary arsenic species concentration in residents living near abandoned metal mines in South Korea. Ann Occup Environ Med. 2016; 28: 67.
    Pubmed KoreaMed CrossRef
  26. Fu S, Wu J, Li Y, Liu Y, Gao Y, Yao F, et al. Urinary arsenic metabolism in a Western Chinese population exposed to high-dose inorganic arsenic in drinking water: influence of ethnicity and genetic polymorphisms. Toxicol Appl Pharmacol. 2014; 274(1): 117-123.
    Pubmed CrossRef
  27. Schläwicke Engström K, Nermell B, Concha G, Strömberg U, Vahter M, Broberg K. Arsenic metabolism is influenced by polymorphisms in genes involved in one-carbon metabolism and reduction reactions. Mutat Res. 2009; 667(1-2): 4-14.
    Pubmed CrossRef
  28. Huang YK, Tseng CH, Huang YL, Yang MH, Chen CJ, Hsueh YM. Arsenic methylation capability and hypertension risk in subjects living in arseniasis-hyperendemic areas in southwestern Taiwan. Toxicol Appl Pharmacol. 2007; 218(2): 135-142.
    Pubmed CrossRef
  29. Li X, Li B, Xu Y, Wang Y, Jin Y, Itoh T, et al. Arsenic methylation capacity and its correlation with skin lesions induced by contaminated drinking water consumption in residents of chronic arsenicosis area. Environ Toxicol. 2011; 26(2): 118-123.
    Pubmed CrossRef
  30. Melak D, Ferreccio C, Kalman D, Parra R, Acevedo J, Pérez L, et al. Arsenic methylation and lung and bladder cancer in a case-control study in northern Chile. Toxicol Appl Pharmacol. 2014; 274(2): 225-231.
    Pubmed KoreaMed CrossRef
  31. Fujihara J, Soejima M, Koda Y, Kunito T, Takeshita H. Asian specific low mutation frequencies of the M287T polymorphism in the human arsenic (+3 oxidation state) methyltransferase (AS3MT) gene. Mutat Res. 2008; 654(2): 158-161.
    Pubmed CrossRef
  32. González-Martínez F, Sánchez-Rodas D, Varela NM, Sandoval CA, Quiñones LA, Johnson-Restrepo B. As3MT and GST polymorphisms influencing arsenic metabolism in human exposure to drinking groundwater. Int J Mol Sci. 2020; 21(14): 4832.
    Pubmed KoreaMed CrossRef
  33. Steinmaus C, Moore LE, Shipp M, Kalman D, Rey OA, Biggs ML, et al. Genetic polymorphisms in MTHFR 677 and 1298, GSTM1 and T1, and metabolism of arsenic. J Toxicol Environ Health A. 2007; 70(2): 159-170.
    Pubmed CrossRef
  34. De Chaudhuri S, Ghosh P, Sarma N, Majumdar P, Sau TJ, Basu S, et al. Genetic variants associated with arsenic susceptibility: study of purine nucleoside phosphorylase, arsenic (+3) methyltransferase, and glutathione S-transferase omega genes. Environ Health Perspect. 2008; 116(4): 501-505.
    Pubmed KoreaMed CrossRef
  35. Luo L, Li Y, Gao Y, Zhao L, Feng H, Wei W, et al. Association between arsenic metabolism gene polymorphisms and arsenic-induced skin lesions in individuals exposed to high-dose inorganic arsenic in northwest China. Sci Rep. 2018; 8(1): 413.
    Pubmed KoreaMed CrossRef
  36. Chen JW, Wang SL, Wang YH, Sun CW, Huang YL, Chen CJ, et al. Arsenic methylation, GSTO1 polymorphisms, and metabolic syndrome in an arseniasis endemic area of southwestern Taiwan. Chemosphere. 2012; 88(4): 432-438.
    Pubmed CrossRef
  37. Paiva L, Marcos R, Creus A, Coggan M, Oakley AJ, Board PG. Polymorphism of glutathione transferase Omega 1 in a population exposed to a high environmental arsenic burden. Pharmacogenet Genomics. 2008; 18(1): 1-10.
    Pubmed CrossRef
  38. Board PG, Coggan M, Chelvanayagam G, Easteal S, Jermiin LS, Schulte GK, et al. Identification, characterization, and crystal structure of the Omega class glutathione transferases. J Biol Chem. 2000; 275(32): 24798-24806.
    Pubmed CrossRef
  39. Xu Y, Li X, Zheng Q, Wang H, Wang Y, Sun G. Lack of association of glutathione-S-transferase omega 1(A140D) and omega 2 (N142D) gene polymorphisms with urinary arsenic profile and oxidative stress status in arsenic-exposed population. Mutat Res. 2009; 679(1-2): 44-49.
    Pubmed CrossRef
  40. Chung CJ, Pu YS, Su CT, Huang CY, Hsueh YM. Gene polymorphisms of glutathione S-transferase omega 1 and 2, urinary arsenic methylation profile and urothelial carcinoma. Sci Total Environ. 2011; 409(3): 465-470.
    Pubmed CrossRef
  41. Tanaka-Kagawa T, Jinno H, Hasegawa T, Makino Y, Seko Y, Hanioka N, et al. Functional characterization of two variant human GSTO 1-1s (Ala140Asp and Thr217Asn). Biochem Biophys Res Commun. 2003; 301(2): 516-520.
    CrossRef
  42. Whitbread AK, Tetlow N, Eyre HJ, Sutherland GR, Board PG. Characterization of the human Omega class glutathione transferase genes and associated polymorphisms. Pharmacogenetics. 2003; 13(3): 131-144.
    Pubmed CrossRef

Article

Original Article

J Environ Health Sci. 2021; 47(6): 530-539

Published online December 31, 2021 https://doi.org/10.5668/JEHS.2021.47.6.530

Copyright © The Korean Society of Environmental Health.

MTHFR, As3MT and GSTO1 Polymorphisms Influencing Arsenic Metabolism in Residents Near Abandoned Metal Mines in South Korea

Ulziikhishig Surenbaatar1 , Byoung-Gwon Kim1 , Hyun-Jin Son1 , Seong-Sik Cho2 , Gwon-Min Kim3,4 , Hyoun-Ju Lim3 , Jung-Yeon Kwon1 , Ki-Hwan Kim5 , Young-Seoub Hong1,3*

1Department of Preventive Medicine, College of Medicine, Dong-A University, 2Department of Occupational and Environmental Medicine, College of Medicine, Dong-A University, 3Heavy Metal Exposure Environmental Health Center, Dong-A University, 4Medical Research Institute, Pusan National University, 5GENCUBEPLUS Co., Ltd

Correspondence to:Department of Preventive Medicine, College of Medicine, Dong-A University, 32, Daesin gongwon-ro, Seo-gu, Busan 49201, Republic of Korea
Tel: +82-51-240-2888
Fax: +82-51-253-5729
E-mail: yshong@dau.ac.kr

Received: September 28, 2021; Revised: November 25, 2021; Accepted: November 25, 2021

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background: In South Korea, areas around abandoned metal mines are designated as regions with high arsenic (As) contamination. However, studies assessing urinary As exposure, As metabolism, and relevant genetic polymorphisms in residents of these metal mine areas are lacking.
Objectives: To identify factors associated with As exposure and evaluate the effects of MTHFR, As3MT, and GSTO1 genetic polymorphisms on As metabolism in residents of abandoned metal mine areas by measuring urinary As species.
Methods: Urinary As species (arsenite [As3+], arsenate [As5+], monomethyl arsonic acid, and dimethylarsinic acid) were isolated using high-performance liquid chromatography in combination with inductively coupled plasma mass spectrometry (HPLC-ICP-MS). Four genetic polymorphisms (MTHFR A222V, MTHFR E429A, GSTO1 A140D, As3MT M287T) were analyzed in 144 residents of four areas around abandoned metal mines.
Results: The study sample was comprised of 34.7% men and 65.3% women, with a mean age of 70.7±10.9 years. The urinary inorganic As concentration was higher among those consuming more than half locally produced rice (0.31 μg/L) than those consuming less than half such rice (0.18 μg/L). The urinary dimethylarsinic acid concentration was higher in the group that had consumed seafood in the past day (31.68 μg/L) than in those who had not (22.37 μg/L). Furthermore, individuals heterozygous in the MTHFR A222V and GSTO1 A140D polymorphism had higher urinary arsenic species concentrations than did individuals with a wild type or homozygous for the variant allele.
Conclusions: Consumption of locally produced rice was associated with inorganic As exposure, whereas seafood consumption was associated with organic As exposure among residents of abandoned metal mine areas. There was no clear association between MTHFR A222V and GSTO1 A140D polymorphisms and As metabolism.

Keywords: Urinary arsenic speciation, genetic polymorphisms, MTHFR, As3MT, GST01, abandoned metal mine

I. 서 론

비소는 환경 및 생태계에서 무기비소, 유기비소의 다양한 형태로 존재하며 그 형태에 따라 독성은 다양하게 나타난다.1) 무기비소는 환경 중에 널리 분포하는 주요 환경오염물질이며,2) 275가지 유해 환경오염물질 가운데 인체위해도가 높은 물질 중 하나이며 공중보건학적인 중요성이 높다.3)

무기비소의 주요 노출원은 비소에 오염된 물과 오염된 토양에서 재배된 쌀 등 농작물이며 유기비소의 경우 비소 함유량이 비교적 높은 어패류와 해조류 등의 식품의 섭취로 인해 주로 소화기계를 통해 노출된다. 특히 비소는 경구 섭취하였을 때, 소화관에서의 흡수율이 다른 중금속과는 달리 90% 정도로 매우 높다.4-6)

환경 중 무기비소는 인체 노출 흡수 후 위장관에서 arsenite (As3+), arsenate (As5+)로 빠르게 흡수된다. 이들은 인체 내에서 비소의 생체변형(biotransformation)이 일어나고 arsenate (As5+)가 inosine이나 thiol compound에 의해 arsenite (As3+)로 환원된다. 대부분의 arsenite (As3+)는 간에서 methylation 작용으로 monomethylarsonic acid (MMA)을 경유하여 dimethylarsinic acid (DMA)로 대사된다7-9)(Fig. 1). 일반적으로 3가 비소화합물이 5가 비소화합물보다 독성이 더 높으며10) 그 중에 MMA3+이 독성이 가장 강한 중간체이다.11,12)

Figure 1. The metabolic pathway of arsenic and methionine and folic acid cycles14,32)

비소 대사에 관여하는 주요 효소는 Purine nucleoside phosphorylase (PNP), 비소 메틸전달 효소(arsenic methyltransferase, As3MT), 글로타티온-S-전달 효소(glutathione-S-transferase, GST) 등 세 그룹으로 분류되는데 모두 유전적 다형성을 지니고 있다. PNP 효소는 arsenate (As5+)의 환원제로 제시되어 있다. 3가 비소 화합물인 arsenite (As3+)가 MMA로 메틸화할 때, 또는 MMA가 DMA로 메틸화할 때 As3MT 유전자가 직접적인 영향을 미치며13) methylenetetrahydrofolate reductase (MTHFR) 유전자는 1-탄소 대사 경로의 다른 요소들에 의존하여 간접적인 영향을 미치는 것으로 알려져 있다.14) Arsenate (As5+)가 arsenite (As3+)로, MMA5+가 MMA3+로, DMA5+가 DMA3+로 환원할 때 glutathione-S-transferase omega (GSTO1) 유전자가 영향을 미치는 것으로 알려져 있다.15)

비소에 노출 시 고혈압, 당뇨, 비만, 고중성지방, 대사증후군 등 만성질환 뿐만 아니라 피부암, 폐암 및 방광암 발생과 상당한 연관성이 있다고 보고되고 있어 비소 노출은 전세계적으로 매우 중요한 공중 보건 문제이다.4) 그럼에도 불구하고 비소가 인체에 영향을 미치는 발암 기전, 질병영향 및 인체 영향 수준에 대해서는 아직까지 명확히 규명되지 않아 많은 연구가 필요하다. 국외에서는 요 중 비소 노출 평가 및 비소 대사산물 패턴에 유전자 다형성이 미치는 영향에 관한 연구가 다수 수행되고 있으나, 국내에서는 이에 대한 연구가 매우 미흡한 실정이다.

폐금속광산 지역은 환경오염 취약지역으로 비소 오염도가 가장 높은 지역으로 분류된다. 본 연구는 폐금속광산 지역 주민을 대상으로 요 중 비소 종 농도를 측정하여 관련 노출 요인 및 MTHFR, As3MT, GSTO1 유전자들의 다형성이 인체 비소 대사에 미치는 영향을 평가하고자 하였다.

Ⅱ. 재료 및 연구방법

1. 연구 대상

2007년 환경부가 실시한 폐금속광산 예비 주민건강영향조사에서 중금속 오염도가 높게 나타난 폐금속광산 지역 중 4개의 폐금속광산 지역을 선정하여 각 지역별 30명을 목표로 모집하였다.

1차년도에 2개 마을의 79명, 2차년도에 역시 2개 마을의 65명을 모집하여 총 144명을 대상으로 조사하였다. 설문조사는 인구학적 및 사회∙경제적 특성, 중금속 취급 직업력 및 광산 관련 직업력, 흡연 및 음주력, 중금속 노출과 관련된 식이습관 등으로 구성된 국립환경과학원의 표준화 설문지를 사용하였다.

2. 요 중 비소 지표

요 중 비소 화학종은 Arsenite (As3+), Arsenate (As5+), Monomethyl arsonic acid (MMA), Dimethylarsinic acid (DMA)로 분리하여 분석하였다. 본 연구에서 As3+와 As5+의 합을 무기비소(inorganic arsenic (iAs))로, MMA와 DMA의 합을 유기비소(organic arsenic)로, As3+, As5+, MMA, DMA의 합을 총 비소(sumAs)로 각각 조작적 정의하였다.

3. 인체시료 체취

전혈 시료는 항응고제(EDTA)가 포함되어 있는 혈액채취용기(Vacutainer royal blue cap)에 채취하였으며 혈액시료는 응고되는 것을 막기 위해 부드럽게 위 아래로 8∼10회 섞어준 뒤 롤믹서(Roll mixer)에서 혼합하여 분석 전까지 –70°C에 보관하였다. 요 시료는 일시뇨로 전용 Urine cup (Polypropylene)을 사용하여 중간뇨를 직접 받도록 설명하여 10 mL 이상 채취한 뒤, 검사기관으로 이송 전까지 4°C에 보관하였다. 요 중 비소 종 분리 분석을 위해 전용 Conical tube (15 mL, Polypropylene)에 5 mL씩 분주하여 분석 시까지 –70°C인 초저온냉동고에 보관하였다.

4. 신체 시료 분석 방법

4.1. 유전자 분석

유전체 DNA는 HiGeneTM Genomic DNA추출 키트(Biofact, 대전, 한국)를 사용하여 혈액 샘플 전체로부터 분리됐다. 시퀀싱 전에, DNA는 95°C에서 15분 변성, 95°C에서 30초 변성의 32사이클, 50°C (Ta)에서 30초 어닐링, 72°C에서 30초 신장, 마지막으로 72°C에서 3분 신장 등의 PCR 조건을 이용하여 개발한 프라이머로 증폭하였다(Table 1). PRIMER 3 버전 0.4.0을 이용하여 프라이머를 설계하였다.

Table 1 . PCR primer pairs and sequencing primer pairs.

PurposeNameSequence 5' to 3'MerTa (°C)*
PCRMTHFR A222V-FGAGGCTGACCTGAAGCACTTG2156
PCR, sequencingMTHFR A222V-RGTGGGGTGGAGGGAGCTTAT20
PCR, sequencingMTHFR E429A-FATTCCTCTTCCCCTGCCTTTG2156
PCRMTHFR E429A-RTCCCCACTCCAGCATCACTC20
PCR, sequencingGSTO1 A140D-FGGGGGCCGATACAGTTAGC1956
PCRGSTO1 A140D-RAGCAAGCCCATGACAAAGTCT21
PCR, sequencingAs3MT M287T-FGAGTGCTGGAGATGAACCGTGA2256
PCRAs3MT M287T-RGGGCAAGAGCAGAAAGAATACCAGA25

*Ta is annealing temperature..



PCR은 30 ng의 DNA 주형, 10 mM의 dNTP, 10배의 반응용 완충액, 순방향 및 역방향 프라이머 각 10 pM, 5U HAN Taq 중합효소로 구성된 총 20 μL의 반응 용액에서 수행하였으며(HanLab, 서울, 한국) 나머지는 증류수로 채워졌다. 그런 다음 각 PCR 제품은 0.5배의 TBE 완충액에서 EtBr로 염색된 1%의 아가로스 젤 위에서 전기 영동 처리하였다.

4.2. 요 중 비소 종 분리 분석

비소화학종 농도 분리 정량을 위해, 요 시료는 0.45 µm 필터로 불순물 제거 후 탈이온수로 10배 희석하였다. Hamilton PRP X-100 column이 장착된 LC/ICP-MS (Agilent Technologies 1,260 series High-Performance Liquid Chromatography/7,700 series Inductively Coupled Plasma-Mass Spectrometer, Agilent, Santa Clara, CA, USA) 장비를 이용하여 As3+, As5+, MMA, DMA의 4개 비소종을 정량 분석하였다. As3+, As5+, MMA, DMA 그리고 standard 시료(Sigma-Aldrich, St. Louis, MO, USA)를 사용하여 Calibration curves을 작성하였고 2개 표준물질(Standard Reference Material 2,669, The National Institute of Standards and Technology, Gaithersburg, MD, USA; Certified Reference Material No. 18, National Institute for Environmental Studies, Onogawa, Tsukuba, Japan)를 이용하여 정확성을 확인하였다. 외부 질 보증은 Friedrich-Alexander University에서 운영하는 German External Quality Assessment Scheme (G-EQUAS)의 Quality Assurance Program에서 인증을 받았다.16)

5. 통계분석방법

통계 분석은 R 통계 패키지를 이용하였다. 요 중 비소 종 농도가 오른 쪽으로 치우친 분포를 보여 자연 로그 변환 후 기하평균(GM), 95% 신뢰구간(95% CI)을 사용하였다. 대상자의 일반적특성 및 유전자형에 따른 요 중 비소 종 농도를 비교하는 데 있어 t-검정(t-test) 및 분산분석(Analysis of variance, ANOVA)을 실시하였다. 모든 검정은 유의수준 5% 미만에서 실시되었다.

Ⅲ. 결 과

1. 대상자의 일반적 특성

대상자들의 일반적 특성은 Table 2와 같다. 성별은 34.7%은 남성, 65.3%은 여성이었으며 평균 연령은 70.7±10.9세로, 70세 이하인 군이 48.6%, 70세 이상인 군이 51.4%를 차지하였다. 주 식수원으로는 지하수나 간이상수도를 음용하는 대상자가 69.2%를 차지하고 있었다. 거주 지역 내에서 생산되는 쌀을 절반 이상 섭취하는 군이 45.8%, 최근 1일 내 해산물을 섭취한 대상자가 40.3%였다. MTHFR A222V 유전자형 분포는 wild형(CC) 34.8%, 이형접합형(CT) 28.9%, 동형접합형(TT) 36.6%, MTHFR E29A 유전자형의 경우 wild형(AA) 81.1%, 이형접합형(AC) 16.8%, 동형접합형(CC) 2.1%, GSTO1 A140D 유전자형 분포는 wild형(CC) 70.4%, 이형접합형(CA) 15.5%, 동형접합형(AA) 14.1%, As3MT M287T 유전자형의 경우 wild형(TT) 96.4%, 이형접합형(TC) 0.7%, 동형접합형(CC) 2.9%로 나타났다.

Table 2 . Study subject general characteristics.

CharacteristicsTotal n (%)
Total144 (100)
Age*Mean±SD70.7±10.9
<7070 (48.6)
≥7074 (51.4)
BMI (kg/m²)*Mean±SD24.4±3.44
<2587 (60.4)
≥2557 (39.6)
Month income (₩10,000)No response19 (15.8)
<5073 (60.8)
50~<20013 (10.8)
≥20015 (12.5)
Smoking statusCurrent smoker17 (11.8)
Former20 (13.9)
Never107 (74.3)
Drinking statusCurrent52 (36.1)
Former22 (15.3)
Never70 (48.6)
Drink waterGround water99 (69.2)
Other44 (30.8)
Mining work experienceYes14 (9.7)
No130 (90.3)
PesticideYes90 (62.5)
No54 (37.5)
Intake of locally grown riceMore than half66 (45.8)
Less than half78 (54.2)
Intake of seafood in last one dayYes58 (40.3)
No86 (59.7)
MTHFR A222V (C→T)CC47 (34.8)
CT39 (28.9)
TT49 (36.3)
MTHFR E429A (A→C)AA116 (81.1)
AC24 (16.8)
CC3 (2.1)
GSTO1 A140D (C→A)C/C100 (70.4)
C/A22 (15.5)
A/A20 (14.1)
As3MT M287T (T→C)T/T134 (96.4)
T/C1 (0.7)
C/C4 (2.9)

SD: Standard deviation, *Cut point is median value of this variable..



2. 대상자 일반적 특성에 따른 요 중 비소 농도

대상자의 일반적 특성에 따른 요 중 비소 농도는 Table 3과 같다. 성별로는 모든 비소 종 농도가 남성이 여성에 비해 높았으나 통계적으로 유의하지 않았다. 연령에 따른 요중 비소 종 농도는 통계적으로 유의한 차이가 관찰되지 않았다. 가정의 주 식수로 지하수를 이용하는 군의 무기비소는 그 외의 식수를 이용하는 군과 농도 차이가 관찰되지 않았다. 반면 MMA와 DMA가 지하수를 이용하는 군이 그 외의 식수를 이용하는 군에 비해 높았으나 통계적으로 유의하지 않았다. 무기비소의 경우 거주 지역 내 생산되는 쌀을 절반 이상 섭취하는 경우 0.31 (0.22~0.45) μg/L로서 절반 미만을 섭취하는 군 0.18 (0.13~0.26) μg/L에 비해 통계적으로 유의하게 높았으며 MMA와 DMA의 경우도 역시 각각 0.62 (0.37~1.00) μg/L, 35.08 (27.69~44.11) μg/L로서 거주 지역 내 생산되는 쌀을 절반 이상 섭취하는 군이 절반 미만 섭취하는 군의 MMA 0.24 (0.14~0.41) μg/L 및 DMA 17.47 (13.67~22.92) μg/L에 비해서 유의하게 높은 농도로 관찰되었다. 최근 1일 내 해산물을 섭취한 군의 DMA 농도가 31.68 (23.47~42.96) μg/L로서 해산물을 섭취하지 않은 군 22.37 (18.14~22.88) μg/L에 비해서 통계적으로 유의하게 높았다.

Table 3 . Urinary arsenic species concentration by subject characteristics (μg/L).

TotalArsenic measures GM (95% CI)

iAsMMADMAsumAs




0.25 (0.20~0.31)0.41 (0.30~0.57)25.73 (21.92~30.63)27.79 (23.65~32.85)
Gender
Male (n=50)0.29 (0.19~0.44)0.52 (0.27~0.95)31.14 (22.77~42.35)33.65 (24.60~45.68)
Female (n=94)0.23 (0.17~0.30)0.36 (0.24~0.55)23.25 (18.80~28.75)25.09 (20.32~30.89)
Age
<70 (n=70)0.26 (0.19~0.38)0.38 (0.22~0.67)31.12 (23.90~39.53)33.35 (25.56~42.36)
≥70 (n=74)0.24 (0.17~0.33)0.43 (0.26~0.68)21.50 (16.80~27.05)23.38 (18.27~29.44)
BMI
<25 (n=87)0.25 (0.18~0.36)0.39 (0.24~0.60)23.79 (19.08~29.36)25.68 (20.62~31.62)
≥25 (n=57)0.24 (0.17~0.35)0.44 (0.24~0.81)29.01 (20.80~39.25)31.33 (22.63~42.13)
Smoking status
Current (n=17)0.37 (0.17~0.78)0.37 (0.13~1.09)20.62 (11.61~35.36)22.47 (12.55~38.33)
Former (n=20)0.18 (0.10~0.33)0.39 (0.13~1.23)28.35 (17.65~44.33)30.23 (18.18~48.13)
Never (n=107)0.25 (0.19~0.33)0.41 (0.27~0.62)26.18 (21.31~31.95)28.29 (23.16~34.47)
Drinking status
Current (n=52)0.20 (0.14~0.29)0.32 (0.18~0.58)24.54 (18.45~31.93)26.10 (19.58~33.92)
Former (n=22)0.29 (0.16~0.54)0.83 (0.36~1.93)23.91 (14.13~39.66)26.83 (16.12~44.14)
Never (n=70)0.28 (0.19~0.39)0.39 (0.24~0.65)27.28 (21.35~35.67)29.43 (23.04~38.39)
Drink water
Ground water (n=99)0.24 (0.18~0.33)0.50 (0.33~0.76)27.23 (21.96~33.44)29.48 (23.76~36.22)
Other (n=44)0.25 (0.17~0.41)0.27 (0.14~0.54)22.65 (16.11~32.06)24.31 (17.30~34.07)
Mining work experience
Yes (n=14)0.21 (0.10~0.48)0.26 (0.07~1.02)17.67 (9.68~32.49)19.50 (10.56~35.47)
No (n=130)0.25 (0.20~0.33)0.43 (0.28~0.62)26.80 (22.18~32.12)28.86 (23.92~34.55)
Pesticide
Yes (n=90)0.29 (0.22~0.41)*0.47 (0.29~0.73)25.99 (21.28~32.21)28.20 (23.12~34.87)
No (n=54)0.18 (0.13~0.27)0.32 (0.17~0.57)25.31 (18.54~33.94)27.11 (19.94~35.99)
Intake of locally grown rice
Less than half (n=64)0.18 (0.13~0.26)***0.24 (0.14~0.41)***17.47 (13.67~22.92)***18.81 (14.74~24.58)***
More than half (n=80)0.31 (0.22~0.45)0.62 (0.37~1.00)35.08 (27.69~44.11)37.96 (29.96~47.70)
Intake of seafood
Yes (n=58)0.20 (0.14~0.30)0.34 (0.18~0.66)31.68 (23.47~42.96)*33.24 (24.43~45.13)*
No (n=86)0.29 (0.21~0.39)0.46 (0.29~0.72)22.37 (18.14~22.88)24.62 (19.91~30.44)

GM: geometric means, CI: confidence interval, ANOVA: analysis of variance. The p-value indicates the difference of urinary arsenic species concentration between subgroups using 1-way ANOVA or independent sample T-test..

*p<0.05, **p<0.01, ***p<0.001..



3. 유전자형에 따른 요 중 비소 농도

유전자형에 따른 요 중 비소 종별 농도가 Table 4에 제시되어 있다. MTHFR A222V 유전자의 경우 이형접합형(CT)을 보인 군의 무기비소, MMA 및 DMA가 wild형(CC) 및 동형접합형(TT)에 비해 통계적으로 유의하게 높은 농도를 보였다. 무기비소를 제외한 MTHFR E429A 유전자형에 따른 요 중 비소종별 농도의 유의한 차이는 관찰되지 않았다. MTHFR E429A 유전자형의 이형접합형/동형접합형(AC+CC) 군의 무기비소 농도는 wild형(AA)보다 유의하게 높은 농도로 확인되었다. GSTO1 A140D 유전자의 경우 무기비소는 이형접합형(CA)가 wild형(CC)과 동형접합형(AA)에 비해서 높은 농도를 보였으나 통계적으로 유의하지 않았다. 반면에 MMA과 DMA가 GSTO1 A140D 유전자의 이형접합형(CA)에서 wild형(CC)과 동형접합형(AA)을 보인 군에 비해서 유의하게 높았다(Fig. 2). As3MT M287T 유전자형에 따른 요 중 비소 농도의 뚜렷한 차이는 관찰되지 않았다.

Table 4 . Urinary arsenic species concentration by genotype (μg/L).

TotalArsenic measures GM (95% CI)

iAsMMADMAsumAs




0.25 (0.20~0.31)0.41 (0.30~0.57)25.73 (21.92~30.63)27.79 (23.65~32.85)
MTHFR A222V
CC (n=47)0.27 (0.18~0.41)***ab0.35 (0.19~0.67)***b23.77 (17.57~32.72)***ab25.68 (19.12~34.93)***ab
CT (n=39)0.33 (0.19~0.58)a0.79 (0.40~1.61)a48.47 (37.91~61.27)a52.72 (41.75~65.97)a
TT (n=49)0.17 (0.12~0.25)b0.25 (0.15~0.45)b16.39 (12.15~22.08)b17.57 (13.02~23.77)b
MTHFR E429A
AA (n=116)0.24 (0.18~0.31)*0.40 (0.27~0.60)23.59 (19.22~29.06)25.45 (20.85~31.45)
AC+CC (n=27)0.30 (0.17~0.57)0.42 (0.17~1.07)37.25 (27.52~50.40)40.38 (29.68~54.58)
GSTO1 A140D
C/C (n=100)0.23 (0.17~0.30)0.41 (0.26~0.63)**ab26.52 (21.18~32.48)**ab28.60 (23.00~34.94)**ab
C/A (n=22)0.35 (0.18~0.70)0.61 (0.19~1.64)a42.10 (28.73~58.90)a45.95 (31.49~64.38)a
A/A (n=20)0.26 (0.14~0.49)0.21 (0.09~0.51)b13.57 (9.16~20.73)b14.53 (9.69~22.47)b
As3MT M287T
T/T (n=134)0.24 (0.19~0.31)0.42 (0.29~0.64)25.87 (21.50~31.03)27.92 (23.20~33.53)
T/C (n=1)2.85 (0.00~0.00)0.04 (0.00~0.00)10.96 (0.00~0.00)13.86 (0.00~0.00)
C/C (n=4)0.15 (0.08~0.59)0.28 (0.03~2.75)10.20 (2.70~54.58)11.03 (2.81~59.31)

GM: geometric means, CI: confidence interval, ANOVA: analysis of variance. The p-value indicates the difference of urinary arsenic species concentration between subgroups using 1-way ANOVA or independent sample T-test; abc, Bonferroni post-hoc grouping; estimates with the same letter are not significantly different..

*p<0.05, **p<0.01, ***p <0 .001..


Figure 2. The geometric mean of the iAs, MMA and DMA by genotype of MTHFR A222V, MTHFR E429A and GSTO1 A140D
aHeterozygotes and homozygotes for the variant allele in the MTHFR E429A polymorphism are combined.
*p<0.05, **p<0.01, ***p<0.001

Ⅳ. 고 찰

본 연구에서 폐금속광산 지역 주민의 요 중 비소 종 농도 측정 및 인체 비소 대사와 관련된 유전자 다형성에 대한 분석을 하였으며 거주 지역 내 생산되는 쌀을 절반 이상 섭취하는 경우 절반 미만을 섭취하는 군에 비하여 요 중 무기비소 농도가 높았다. 최근 1일 내 해산물을 섭취한 군의 요 중 DMA 농도가 해산물을 섭취하지 않은 군에 비하여 높은 결과를 보였다. MTHFR A222V 및 GSTO1 A140D 유전자의 이형접합형이 wild형 및 동형접합형에 비하여 비소 종 농도가 높은 것으로 나타났다. 비소 대사와 관련된 효소 조절에서의 유전적 다형성이 개인과 인구 집단 간 비소 대사의 현저한 차이의 한 가지 원인이 될 수 있다. 따라서 본 연구 결과를 통해 비소노출 취약지역 주민의 비소생체지표 농도를 예측하는 또는 영향을 미치는 요소를 식별하여 이를 기반으로 위험군을 선별하여 관리할 수 있다.

다양한 인구 집단에서 요 중 비소 대사 산물의 비율은 비소 노출 수준과 상관 없이 일반적으로 10~30%를 iAs, 10~20%를 MMA, 60~80%를 DMA가 차지한다.17) 그러나 개인 및 인구 집단 간의 요 중 비소 패턴은 상당한 차이가 있다. 특히 DMA는 지배적인 메틸화 비소 종으로 간주된다.18) 그럼에도 불구하고 한국인들은 해산물 섭취가 다소 높기 때문에 요 중 DMA 비율이 더 높은 편이다.19) 본 연구에서 요 중 비소 대사 산물의 비율 순서는 %DMA>%MMA>%iAs이었다. 일부 연구에서는 음용수를 통해 비소 노출 후 배출된 주요 비소 대사 산물이 %DMA>%iAs>%MMA 순이었다.20,21) 본 연구에서 요 중 비소 대사 산물의 평균 비율이 iAs-2.58%, MMA-4.49%, DMA-92.93%이었다.

체질량지수는 비만 및 영양 상태를 나타내는 지표로서 비소 대사에 영향을 미칠 수 있다. BMI와 비소 메틸화 효율 간의 상관성을 평가한 연구에서 BMI가 증가할수록 %MMA가 감소한 것을 확인하였다.22) 그러나 본 연구에서는 BMI와 요 중 비소 종 농도의 연관성을 확인하지 못하였다. 많은 선행 연구들에서 성별, 연령, 체질량지수가 비소 대사에 영향을 미친다는 것을 보고하였지만 본 연구에서는 연관성을 확인하지 못한 것은 대상자 수가 적기 때문일 수 있으며 추후 대규모 대상자로 연구할 필요성이 있다.

무기비소의 노출은 주로 식습관과 식수를 통해 발생하며 저농도의 비소오염 식수는 무기비소 노출의 중요한 원인이 될 수 있다. Chang 등23) 의 연구에서 오염된 일부 폐광산지역 주민을 대상으로 요 중 비소 종분리 분석한 연구에서 무기비소 기하평균이 상수도 공급 시행 전 23.13 μg/L이었으며, 상수도 공급 시행 후 1.70 μg/L로 대폭 감소한 것으로 보고하였다. 또한 거주 지역 내에서 생산된 쌀을 섭취하는 군의 요 중 총 비소 농도가 높았다.23) 폐광산 지역에서 실시한 다른 연구에서도 무기비소의 노출 요인으로 음용수의 비소오염 및 지역 내에서 생산된 쌀을 섭취하는 것을 들었으며19,24,25) 본 연구에서도 지역 내에서 생산된 쌀을 절반 이상 섭취하는 군이 절반 미만을 섭취하는 군에 비하여 요 중 무기비소 농도가 유의하게 높은 것으로 확인되었다. 따라서 오염지역의 식수와 농산물을 섭취하는 폐금속광산지역이 비소노출의 취약지역임을 알 수 있으며 폐금속광산지역 주민의 비소노출에 대한 지속적인 건강영향 관리체계의 구축이 필요하다.

한국인은 해산물 섭취량이 많기 때문에 비소에 대한 노출을 평가하는 데 있어서 해산물 섭취가 고려되어야 할 중요한 요인이다. 본 연구에서는 최근 1일 내 해산물을 섭취한 군의 요 중 DMA 농도가 해산물을 섭취하지 않은 군에 비하여 유의하게 높은 결과를 보였다. 해산물의 영향을 배제하려면 며칠간 해산물 섭취를 금식한 상태에서 측정해야 하나 본 연구에서는 금식 조절을 하지 못하였으며 추후 연구에서는 해산물을 금식한 상태에서 조사할 필요성이 있다.

많은 연구에 따르면 식습관, 성별, 연령, 체질량지수 및 개인의 생활습관과 같은 개인적 특성과 환경 요인들이 비소 대사에 영향을 미친 것으로 나타났다.8,26,27) 최근 역학 연구에서 비소 메틸화 능력 저하는 피부병변, 피부암, 방광암, 고혈압 등과 같은 비소 노출과 관련된 질병과 관련이 있는 것으로 보고되고 있다.28-30)

본 연구에서 As3MT M287T 유전자의 이형접합형을 가진 사람은 한 명, 동형접합형을 가진 사람은 네 명으로 나타났으며 이러한 유전자 다형성의 낮은 빈도는 다른 아시아인을 대상으로 한 연구 결과와 유사하였다.31) Lindberg 등14)As3MT M287T 유전자의 다형성, 성별 및 체질량지수는 중부 유럽 인구의 요 중 비소 대사에 영향을 미치는 주요 요인으로 보고하였다. González-Martínez 등32)의 연구에서 As3MT M287T 이형접합/동형접합형은 DMA의 더 낮은 농도와 관련이 있는 것으로 보고하였다. 또한 González-Martínez 등32)As3MT M287T의 이형접합/동형접합형은 wild형에 비하여 %MMA가 더 높은 것을 확인하였으며 이러한 결과는 유럽, 아시아 및 중남미 인구에서 보고된 것과 유사했다고 보고되었다. 그러나 본 연구에서는 성별, 연령, 체질량지수 및 As3MT 유전자의 다형성이 요 중 비소 대사와 관련이 없는 것으로 관찰되었다. 향후 대규모 집단을 대상으로 As3MT 유전자 내 다른 SNP들을 연구할 필요가 있다.

Lindberg 등14)의 연구에서 MTHFR A222V 유전자의 동형접합형에서 더 높은 %MMA를 확인하였는데, 그 결과는 본 연구와 상반 결과였으며 더 낮은 %DMA는 본 연구의 MTHFR A222V 유전자의 동형접합형에서 DMA 농도가 낮은 결과와 유사하였다. Steinmaus 등33)의 연구에서는 본 연구와 동일하게 MTHFR A222V 및 E429A 유전자형이 비소 대사에 미치는 영향을 조사하였으며 A222V 유전자형의 동형접합형이 높은 농도의 iAs와 관련이 있다는 것은 본 연구 결과와 다른 반면, 낮은 농도의 DMA와 관련이 있다는 것은 본 연구와 유사하였다. 또한 E429A 유전자형의 wild형이 iAs의 높은 농도 및 DMA의 낮은 농도를 보여 주는 결과는 본 연구와 상반 결과를 보였다.33) MTHFR 유전자는 메틸렌테트라하이드로폴레이트(methylenetetrahydrofolate)를 메틸테트라하이드로폴레이트(methyltetrahydrofolate)로 환원시키는데, 이는 메틸화된 비타민 B12를 공통 인자로 하여 1-탄소 대사에서 호모시스테인(homocysteine)으로부터 메티오닌(methionine)을 재생한다(Fig. 1). MTHFR A222V 유전자의 다형성은 효소 활동 감소 및 억제를 통해 더 낮은 SAM-의존성 메메틸화로 이어질 수 있어 본 연구의 MTHFR A222V 유전자의 이형접합형에서 더 높은 비소 농도 결과를 설명할 수 있다.

GSTO1 유전자의 A140D 대립유전자의 빈도는 세계 인구마다 크게 다르다.34) 본 연구에서 GSTO1 A140D 유전자 다형성 빈도는 인도의 연구 및 중국의 연구와 비슷하였으며 이는 아시아 인구 내 유사성을 반영한다. Luo 등35)의 중국인을 대상으로 한 연구에서 GSTO1 A140D 유전자의 이형접합형을 지닌 대상자가 wild형을 지닌 대상자에 비하여 GSTO1 효소 활동이 감소한 것으로 나타났으며 이러한 결과는 본 연구와 유사하였다. Fu 등26)GSTO1 A140D 유전자의 이형접합형이 wild형에 비하여 %DMA가 유의하게 낮은 것을 보고하였으며 이러한 결과는 본 연구에서 확인한 GSTO1 A140D 유전자의 이형접합형과 DMA 농도의 증가와 유의한 관련이 있다는 것과 상반된 내용이다. 반면에 Chen 등36), Pavia 등37)GSTO1 A140D 유전자형은 비소 대사에 크게 영향을 미치지 않는다는 결과를 보고한 바가 있다. 일반적으로 GSTO1 유전자는 다른 GST보다 티올 전이효소 활동이 더 높다.38,39) 또한 Chung 등40)GSTO1 A140D의 wild형을 가진 대상자들이 이형접합형 및 동형접합형을 지닌 대상자와 비교하여 MMA 농도가 유의하게 증가했다고 보고하였다. Tanaka-Kawaga 등41)GSTO1 A140D 변이의 티올 전이효소 활동은 wild형에 대비 75%에 불과하여 A140D 유전자의 다형성은 GSTO1의 티올 전이효소 활동을 감소시킨다고 주장하였다. 따라서 본 연구에서 GSTO1 A140D 유전자 이형접합형을 지닌 대상자의 요 중 MMA 및 DMA 농도가 높은 결과를 GSTO1의 티올 전이효소 활동의 감소로 설명할 수 있으나 Whitbread 등42)GSTO1 A140D 유전자 다형성들 사이에 이러한 효소 활동 차이가 관찰되지 않았다고 보고한 바가 있다. 이와 같이 많은 선행 연구에서 다양한 결과를 보고되고 있다.

본 연구의 MTHFR A222V 및 GSTO1 A140D 유전자의 이형접합형에서 더 높은 비소 농도 결과를 유전자 다형성에 따른 효소 활동 감소로 설명할 수 있으나 동형접합성에서 더 낮은 농도 비소 결과에 대한 설명을 못했다. 이러한 결과는 본 연구의 적은 연구대상자에 의해서 유전자 분포의 영향을 미쳤을 것으로 보인다. 향후 대상자수가 확대된다면 차이점이 보완될 것으로 보인다. 본 연구의 강점으로는, 국내 비소노출의 대표적인 취약지역인 폐금속광산 지역 주민을 대상으로 하였다는 점과 아울러, 비소 대사에 영향을 미치는 유전자 다형성에 대한 국내의 최초 연구라는 점이다. 제한점으로는 첫째, 단면연구로서 비소 노출에 대한 요인분석 파악이 한계가 있었다는 점이다. 둘째, 대상자 수가 부족하였다는 점이다. 셋째, 일시뇨의 농축정도를 보정하는데 이용하는 요중 크레아티닌과 요비중을 측정하지 못하였다는 점이다. 향후, 한국인의 인체 비소 대사와 관련이 있는 유전적 특성에 대한 대규모의 전향적 연구가 수행되기를 바란다.

Ⅴ. 결 론

폐금속광산 지역 주민의 요 중 무기비소의 노출 요인은 지역 내에서 생산된 쌀 섭취로, 유기비소의 노출 요인은 해산물 섭취로 분석되었다. MTHFR A222V, GSTO1 A140D 유전자 다형성과 비소 대사와의 명확한 상호작용을 나타내지 못했다. 비소의 위험성과 공중보건학적인 중요성을 고려할 때 본 연구는 비소 취약지역 주민을 대상으로 노출 및 대사 특성을 규명하고자 시도한 연구로써 의미가 크다. 향후 대규모 집단을 대상으로 비소 대사 관련 연구가 확대되기를 바란다.

감사의 글

본 연구는 환경부 지정 동아대학교 중금속노출 환경보건센터의 지원을 받아 수행되었으며 이에 감사드립니다(IRB No. 2-1040709-AB-N-01-201908-BR-012-04).

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

<저자정보>

울지(연구원), 김병권(교수), 손현진(교수), 조성식(교수), 김권민(연구원), 임현주(연구원), 권정연(연구원), 김기환(대표), 홍영습(교수)

Fig 1.

Figure 1.The metabolic pathway of arsenic and methionine and folic acid cycles14,32)
Journal of Environmental Health Sciences 2021; 47: 530-539https://doi.org/10.5668/JEHS.2021.47.6.530

Fig 2.

Figure 2.The geometric mean of the iAs, MMA and DMA by genotype of MTHFR A222V, MTHFR E429A and GSTO1 A140D
aHeterozygotes and homozygotes for the variant allele in the MTHFR E429A polymorphism are combined.
*p<0.05, **p<0.01, ***p<0.001
Journal of Environmental Health Sciences 2021; 47: 530-539https://doi.org/10.5668/JEHS.2021.47.6.530

Table 1 PCR primer pairs and sequencing primer pairs

PurposeNameSequence 5' to 3'MerTa (°C)*
PCRMTHFR A222V-FGAGGCTGACCTGAAGCACTTG2156
PCR, sequencingMTHFR A222V-RGTGGGGTGGAGGGAGCTTAT20
PCR, sequencingMTHFR E429A-FATTCCTCTTCCCCTGCCTTTG2156
PCRMTHFR E429A-RTCCCCACTCCAGCATCACTC20
PCR, sequencingGSTO1 A140D-FGGGGGCCGATACAGTTAGC1956
PCRGSTO1 A140D-RAGCAAGCCCATGACAAAGTCT21
PCR, sequencingAs3MT M287T-FGAGTGCTGGAGATGAACCGTGA2256
PCRAs3MT M287T-RGGGCAAGAGCAGAAAGAATACCAGA25

*Ta is annealing temperature.


Table 2 Study subject general characteristics

CharacteristicsTotal n (%)
Total144 (100)
Age*Mean±SD70.7±10.9
<7070 (48.6)
≥7074 (51.4)
BMI (kg/m²)*Mean±SD24.4±3.44
<2587 (60.4)
≥2557 (39.6)
Month income (₩10,000)No response19 (15.8)
<5073 (60.8)
50~<20013 (10.8)
≥20015 (12.5)
Smoking statusCurrent smoker17 (11.8)
Former20 (13.9)
Never107 (74.3)
Drinking statusCurrent52 (36.1)
Former22 (15.3)
Never70 (48.6)
Drink waterGround water99 (69.2)
Other44 (30.8)
Mining work experienceYes14 (9.7)
No130 (90.3)
PesticideYes90 (62.5)
No54 (37.5)
Intake of locally grown riceMore than half66 (45.8)
Less than half78 (54.2)
Intake of seafood in last one dayYes58 (40.3)
No86 (59.7)
MTHFR A222V (C→T)CC47 (34.8)
CT39 (28.9)
TT49 (36.3)
MTHFR E429A (A→C)AA116 (81.1)
AC24 (16.8)
CC3 (2.1)
GSTO1 A140D (C→A)C/C100 (70.4)
C/A22 (15.5)
A/A20 (14.1)
As3MT M287T (T→C)T/T134 (96.4)
T/C1 (0.7)
C/C4 (2.9)

SD: Standard deviation, *Cut point is median value of this variable.


Table 3 Urinary arsenic species concentration by subject characteristics (μg/L)

TotalArsenic measures GM (95% CI)

iAsMMADMAsumAs




0.25 (0.20~0.31)0.41 (0.30~0.57)25.73 (21.92~30.63)27.79 (23.65~32.85)
Gender
Male (n=50)0.29 (0.19~0.44)0.52 (0.27~0.95)31.14 (22.77~42.35)33.65 (24.60~45.68)
Female (n=94)0.23 (0.17~0.30)0.36 (0.24~0.55)23.25 (18.80~28.75)25.09 (20.32~30.89)
Age
<70 (n=70)0.26 (0.19~0.38)0.38 (0.22~0.67)31.12 (23.90~39.53)33.35 (25.56~42.36)
≥70 (n=74)0.24 (0.17~0.33)0.43 (0.26~0.68)21.50 (16.80~27.05)23.38 (18.27~29.44)
BMI
<25 (n=87)0.25 (0.18~0.36)0.39 (0.24~0.60)23.79 (19.08~29.36)25.68 (20.62~31.62)
≥25 (n=57)0.24 (0.17~0.35)0.44 (0.24~0.81)29.01 (20.80~39.25)31.33 (22.63~42.13)
Smoking status
Current (n=17)0.37 (0.17~0.78)0.37 (0.13~1.09)20.62 (11.61~35.36)22.47 (12.55~38.33)
Former (n=20)0.18 (0.10~0.33)0.39 (0.13~1.23)28.35 (17.65~44.33)30.23 (18.18~48.13)
Never (n=107)0.25 (0.19~0.33)0.41 (0.27~0.62)26.18 (21.31~31.95)28.29 (23.16~34.47)
Drinking status
Current (n=52)0.20 (0.14~0.29)0.32 (0.18~0.58)24.54 (18.45~31.93)26.10 (19.58~33.92)
Former (n=22)0.29 (0.16~0.54)0.83 (0.36~1.93)23.91 (14.13~39.66)26.83 (16.12~44.14)
Never (n=70)0.28 (0.19~0.39)0.39 (0.24~0.65)27.28 (21.35~35.67)29.43 (23.04~38.39)
Drink water
Ground water (n=99)0.24 (0.18~0.33)0.50 (0.33~0.76)27.23 (21.96~33.44)29.48 (23.76~36.22)
Other (n=44)0.25 (0.17~0.41)0.27 (0.14~0.54)22.65 (16.11~32.06)24.31 (17.30~34.07)
Mining work experience
Yes (n=14)0.21 (0.10~0.48)0.26 (0.07~1.02)17.67 (9.68~32.49)19.50 (10.56~35.47)
No (n=130)0.25 (0.20~0.33)0.43 (0.28~0.62)26.80 (22.18~32.12)28.86 (23.92~34.55)
Pesticide
Yes (n=90)0.29 (0.22~0.41)*0.47 (0.29~0.73)25.99 (21.28~32.21)28.20 (23.12~34.87)
No (n=54)0.18 (0.13~0.27)0.32 (0.17~0.57)25.31 (18.54~33.94)27.11 (19.94~35.99)
Intake of locally grown rice
Less than half (n=64)0.18 (0.13~0.26)***0.24 (0.14~0.41)***17.47 (13.67~22.92)***18.81 (14.74~24.58)***
More than half (n=80)0.31 (0.22~0.45)0.62 (0.37~1.00)35.08 (27.69~44.11)37.96 (29.96~47.70)
Intake of seafood
Yes (n=58)0.20 (0.14~0.30)0.34 (0.18~0.66)31.68 (23.47~42.96)*33.24 (24.43~45.13)*
No (n=86)0.29 (0.21~0.39)0.46 (0.29~0.72)22.37 (18.14~22.88)24.62 (19.91~30.44)

GM: geometric means, CI: confidence interval, ANOVA: analysis of variance. The p-value indicates the difference of urinary arsenic species concentration between subgroups using 1-way ANOVA or independent sample T-test.

*p<0.05, **p<0.01, ***p<0.001.


Table 4 Urinary arsenic species concentration by genotype (μg/L)

TotalArsenic measures GM (95% CI)

iAsMMADMAsumAs




0.25 (0.20~0.31)0.41 (0.30~0.57)25.73 (21.92~30.63)27.79 (23.65~32.85)
MTHFR A222V
CC (n=47)0.27 (0.18~0.41)***ab0.35 (0.19~0.67)***b23.77 (17.57~32.72)***ab25.68 (19.12~34.93)***ab
CT (n=39)0.33 (0.19~0.58)a0.79 (0.40~1.61)a48.47 (37.91~61.27)a52.72 (41.75~65.97)a
TT (n=49)0.17 (0.12~0.25)b0.25 (0.15~0.45)b16.39 (12.15~22.08)b17.57 (13.02~23.77)b
MTHFR E429A
AA (n=116)0.24 (0.18~0.31)*0.40 (0.27~0.60)23.59 (19.22~29.06)25.45 (20.85~31.45)
AC+CC (n=27)0.30 (0.17~0.57)0.42 (0.17~1.07)37.25 (27.52~50.40)40.38 (29.68~54.58)
GSTO1 A140D
C/C (n=100)0.23 (0.17~0.30)0.41 (0.26~0.63)**ab26.52 (21.18~32.48)**ab28.60 (23.00~34.94)**ab
C/A (n=22)0.35 (0.18~0.70)0.61 (0.19~1.64)a42.10 (28.73~58.90)a45.95 (31.49~64.38)a
A/A (n=20)0.26 (0.14~0.49)0.21 (0.09~0.51)b13.57 (9.16~20.73)b14.53 (9.69~22.47)b
As3MT M287T
T/T (n=134)0.24 (0.19~0.31)0.42 (0.29~0.64)25.87 (21.50~31.03)27.92 (23.20~33.53)
T/C (n=1)2.85 (0.00~0.00)0.04 (0.00~0.00)10.96 (0.00~0.00)13.86 (0.00~0.00)
C/C (n=4)0.15 (0.08~0.59)0.28 (0.03~2.75)10.20 (2.70~54.58)11.03 (2.81~59.31)

GM: geometric means, CI: confidence interval, ANOVA: analysis of variance. The p-value indicates the difference of urinary arsenic species concentration between subgroups using 1-way ANOVA or independent sample T-test; abc, Bonferroni post-hoc grouping; estimates with the same letter are not significantly different.

*p<0.05, **p<0.01, ***p <0 .001.


References

  1. Mandal BK, Suzuki KT. Arsenic round the world: a review. Talanta. 2002; 58(1): 201-235.
    CrossRef
  2. Ministry of Food and Drug Safety/National Institute of Food and Drug Safety Evaluation. Exposure Assessment to Arsenic by Total Arsenic and Speciation Analyses in Urine. Cheongju: Ministry of Food and Drug Safety; 2014. https://scienceon.kisti.re.kr/srch/selectPORSrchReport.do?cn=TRKO201400011751
  3. Agency for Toxic Substances and Disease Registry (ATSDR). Toxicological Profile for Arsenic. 2007. Available: https://www.atsdr.cdc.gov/toxprofiledocs/index.html [accessed 25 April 2021]. https://www.atsdr.cdc.gov/toxprofiledocs/index.html
  4. Hong YS, Ye BJ, Kim YM, Kim BG, Kang GH, Kim JJ, et al. Investigation of health effects according to the exposure of low concentration arsenic contaminated ground water. Int J Environ Res Public Health. 2017; 14(12): 1461.
    Pubmed KoreaMed CrossRef
  5. Seo JW, Choi JW, Oh YJ, Hong YS. Biological monitoring of arsenic concentrations according to exposure to arsenic-contaminated ground water. J Environ Health Sci. 2020; 46(5): 513-524. https://www.kci.go.kr/kciportal/ci/sereArticleSearch/ciSereArtiView.kci?sereArticleSearchBean.artiId=ART002639825
  6. Bae HS, Ryu DY, Choi BS, Park JD. Urinary arsenic concentrations and their associated factors in Korean adults. Toxicol Res. 2013; 29(2): 137-142.
    Pubmed KoreaMed CrossRef
  7. Vahter M. Mechanisms of arsenic biotransformation. Toxicology. 2002; 181-182: 211-217.
    CrossRef
  8. Tseng CH. Arsenic methylation, urinary arsenic metabolites and human diseases: current perspective. J Environ Sci Health C Environ Carcinog Ecotoxicol Rev. 2007; 25(1): 1-22.
    Pubmed CrossRef
  9. Vahter M. Variation in human metabolism of arsenic. In: Chappell WR, Abernathy CO, Calderon RL. editors. Arsenic Exposure and Health Effects III, 1st ed. Oxford: Elsevier Science; 1999. p.267-279. https://www.sciencedirect.com/science/article/pii/B9780080436487500315
    CrossRef
  10. Hughes MF, Beck BD, Chen Y, Lewis AS, Thomas DJ. Arsenic exposure and toxicology: a historical perspective. Toxicol Sci. 2011; 123(2): 305-332.
    Pubmed KoreaMed CrossRef
  11. Petrick JS, Ayala-Fierro F, Cullen WR, Carter DE, Vasken Aposhian H. Monomethylarsonous acid (MMA(III)) is more toxic than arsenite in Chang human hepatocytes. Toxicol Appl Pharmacol. 2000; 163(2): 203-207.
    Pubmed CrossRef
  12. Stýblo M, Drobná Z, Jaspers I, Lin S, Thomas DJ. The role of biomethylation in toxicity and carcinogenicity of arsenic: a research update. Environ Health Perspect. 2002; 110(Suppl 5): 767-771.
    Pubmed KoreaMed CrossRef
  13. Engström K, Vahter M, Mlakar SJ, Concha G, Nermell B, Raqib R, et al. Polymorphisms in arsenic(+III oxidation state) methyltransferase (AS3MT) predict gene expression of AS3MT as well as arsenic metabolism. Environ Health Perspect. 2011; 119(2): 182-188.
    Pubmed KoreaMed CrossRef
  14. Lindberg AL, Kumar R, Goessler W, Thirumaran R, Gurzau E, Koppova K, et al. Metabolism of low-dose inorganic arsenic in a central European population: influence of sex and genetic polymorphisms. Environ Health Perspect. 2007; 115(7): 1081-1086.
    Pubmed KoreaMed CrossRef
  15. McClintock TR, Chen Y, Bundschuh J, Oliver JT, Navoni J, Olmos V, et al. Arsenic exposure in Latin America: biomarkers, risk assessments and related health effects. Sci Total Environ. 2012; 429: 76-91.
    Pubmed KoreaMed CrossRef
  16. Chung JY, Lim HJ, Kim YJ, Song KH, Kim BG, Hong YS. The separation of arsenic metabolites in urine by high performance liquid chromatographyinductively coupled plasma-mass spectrometry. Environ Health Toxicol. 2014; 29: e2014018.
    Pubmed KoreaMed CrossRef
  17. Bustaffa E, Gorini F, Bianchi F, Minichilli F. Factors affecting arsenic methylation in contaminated Italian areas. Int J Environ Res Public Health. 2020; 17(14): 5226.
    Pubmed KoreaMed CrossRef
  18. Tseng CH. A review on environmental factors regulating arsenic methylation in humans. Toxicol Appl Pharmacol. 2009; 235(3): 338-350.
    Pubmed CrossRef
  19. Surenbaatar U, Seo JW, Kim BG, Lim HJ, Chang JY, Lee CW. Urinary arsenic species concentrations and related factors among residents living near abandoned metal mines. J Environ Health Sci. 2020; 46(6): 655-666. https://koreascience.or.kr/article/JAKO202001239070187.view
  20. Sun G, Xu Y, Li X, Jin Y, Li B, Sun X. Urinary arsenic metabolites in children and adults exposed to arsenic in drinking water in Inner Mongolia, China. Environ Health Perspect. 2007; 115(4): 648-652.
    Pubmed KoreaMed CrossRef
  21. Del Razo LM, García-Vargas GG, Vargas H, Albores A, Gonsebatt ME, Montero R, et al. Altered profile of urinary arsenic metabolites in adults with chronic arsenicism. A pilot study. Arch Toxicol. 1997; 71(4): 211-217.
    Pubmed CrossRef
  22. Gomez-Rubio P, Roberge J, Arendell L, Harris RB, O'Rourke MK, Chen Z, et al. Association between body mass index and arsenic methylation efficiency in adult women from southwest U.S. and northwest Mexico. Toxicol Appl Pharmacol. 2011; 252(2): 176-182.
    Pubmed KoreaMed CrossRef
  23. Chang JY, Ahn SC, Lee JS, Kim JY, Jung AR, Park J, et al. Exposure assessment for the abandoned metal mine area contaminated by arsenic. Environ Geochem Health. 2019; 41(6): 2443-2458.
    Pubmed KoreaMed CrossRef
  24. Cho Y, Seo S, Choi SH, Lee S, Kim K, Kim HJ, et al. Association of arsenic levels in soil and water with urinary arsenic concentration of residents in the vicinity of closed metal mines. Int J Hyg Environ Health. 2013; 216(3): 255-262.
    Pubmed CrossRef
  25. Chung JY, Kim BG, Lee BK, Moon JD, Sakong J, Jeon MJ, et al. Urinary arsenic species concentration in residents living near abandoned metal mines in South Korea. Ann Occup Environ Med. 2016; 28: 67.
    Pubmed KoreaMed CrossRef
  26. Fu S, Wu J, Li Y, Liu Y, Gao Y, Yao F, et al. Urinary arsenic metabolism in a Western Chinese population exposed to high-dose inorganic arsenic in drinking water: influence of ethnicity and genetic polymorphisms. Toxicol Appl Pharmacol. 2014; 274(1): 117-123.
    Pubmed CrossRef
  27. Schläwicke Engström K, Nermell B, Concha G, Strömberg U, Vahter M, Broberg K. Arsenic metabolism is influenced by polymorphisms in genes involved in one-carbon metabolism and reduction reactions. Mutat Res. 2009; 667(1-2): 4-14.
    Pubmed CrossRef
  28. Huang YK, Tseng CH, Huang YL, Yang MH, Chen CJ, Hsueh YM. Arsenic methylation capability and hypertension risk in subjects living in arseniasis-hyperendemic areas in southwestern Taiwan. Toxicol Appl Pharmacol. 2007; 218(2): 135-142.
    Pubmed CrossRef
  29. Li X, Li B, Xu Y, Wang Y, Jin Y, Itoh T, et al. Arsenic methylation capacity and its correlation with skin lesions induced by contaminated drinking water consumption in residents of chronic arsenicosis area. Environ Toxicol. 2011; 26(2): 118-123.
    Pubmed CrossRef
  30. Melak D, Ferreccio C, Kalman D, Parra R, Acevedo J, Pérez L, et al. Arsenic methylation and lung and bladder cancer in a case-control study in northern Chile. Toxicol Appl Pharmacol. 2014; 274(2): 225-231.
    Pubmed KoreaMed CrossRef
  31. Fujihara J, Soejima M, Koda Y, Kunito T, Takeshita H. Asian specific low mutation frequencies of the M287T polymorphism in the human arsenic (+3 oxidation state) methyltransferase (AS3MT) gene. Mutat Res. 2008; 654(2): 158-161.
    Pubmed CrossRef
  32. González-Martínez F, Sánchez-Rodas D, Varela NM, Sandoval CA, Quiñones LA, Johnson-Restrepo B. As3MT and GST polymorphisms influencing arsenic metabolism in human exposure to drinking groundwater. Int J Mol Sci. 2020; 21(14): 4832.
    Pubmed KoreaMed CrossRef
  33. Steinmaus C, Moore LE, Shipp M, Kalman D, Rey OA, Biggs ML, et al. Genetic polymorphisms in MTHFR 677 and 1298, GSTM1 and T1, and metabolism of arsenic. J Toxicol Environ Health A. 2007; 70(2): 159-170.
    Pubmed CrossRef
  34. De Chaudhuri S, Ghosh P, Sarma N, Majumdar P, Sau TJ, Basu S, et al. Genetic variants associated with arsenic susceptibility: study of purine nucleoside phosphorylase, arsenic (+3) methyltransferase, and glutathione S-transferase omega genes. Environ Health Perspect. 2008; 116(4): 501-505.
    Pubmed KoreaMed CrossRef
  35. Luo L, Li Y, Gao Y, Zhao L, Feng H, Wei W, et al. Association between arsenic metabolism gene polymorphisms and arsenic-induced skin lesions in individuals exposed to high-dose inorganic arsenic in northwest China. Sci Rep. 2018; 8(1): 413.
    Pubmed KoreaMed CrossRef
  36. Chen JW, Wang SL, Wang YH, Sun CW, Huang YL, Chen CJ, et al. Arsenic methylation, GSTO1 polymorphisms, and metabolic syndrome in an arseniasis endemic area of southwestern Taiwan. Chemosphere. 2012; 88(4): 432-438.
    Pubmed CrossRef
  37. Paiva L, Marcos R, Creus A, Coggan M, Oakley AJ, Board PG. Polymorphism of glutathione transferase Omega 1 in a population exposed to a high environmental arsenic burden. Pharmacogenet Genomics. 2008; 18(1): 1-10.
    Pubmed CrossRef
  38. Board PG, Coggan M, Chelvanayagam G, Easteal S, Jermiin LS, Schulte GK, et al. Identification, characterization, and crystal structure of the Omega class glutathione transferases. J Biol Chem. 2000; 275(32): 24798-24806.
    Pubmed CrossRef
  39. Xu Y, Li X, Zheng Q, Wang H, Wang Y, Sun G. Lack of association of glutathione-S-transferase omega 1(A140D) and omega 2 (N142D) gene polymorphisms with urinary arsenic profile and oxidative stress status in arsenic-exposed population. Mutat Res. 2009; 679(1-2): 44-49.
    Pubmed CrossRef
  40. Chung CJ, Pu YS, Su CT, Huang CY, Hsueh YM. Gene polymorphisms of glutathione S-transferase omega 1 and 2, urinary arsenic methylation profile and urothelial carcinoma. Sci Total Environ. 2011; 409(3): 465-470.
    Pubmed CrossRef
  41. Tanaka-Kagawa T, Jinno H, Hasegawa T, Makino Y, Seko Y, Hanioka N, et al. Functional characterization of two variant human GSTO 1-1s (Ala140Asp and Thr217Asn). Biochem Biophys Res Commun. 2003; 301(2): 516-520.
    CrossRef
  42. Whitbread AK, Tetlow N, Eyre HJ, Sutherland GR, Board PG. Characterization of the human Omega class glutathione transferase genes and associated polymorphisms. Pharmacogenetics. 2003; 13(3): 131-144.
    Pubmed CrossRef
The Korean Society of Environmental Health

Vol.48 No.3
June, 2022

pISSN 1738-4087
eISSN 2233-8616

Frequency: Bimonthly

Current Issue   |   Archives

Stats or Metrics

Share this article on :

  • line